Incidental Mutation 'R5025:Olfr1484'
ID391313
Institutional Source Beutler Lab
Gene Symbol Olfr1484
Ensembl Gene ENSMUSG00000096289
Gene Nameolfactory receptor 1484
SynonymsMOR202-37, GA_x6K02T2RE5P-3917859-3918806
MMRRC Submission 042616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5025 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13583511-13588832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 13585522 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 30 (A30S)
Ref Sequence ENSEMBL: ENSMUSP00000150640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074180] [ENSMUST00000207093] [ENSMUST00000208104] [ENSMUST00000215567] [ENSMUST00000216014] [ENSMUST00000216369] [ENSMUST00000217451]
Predicted Effect probably benign
Transcript: ENSMUST00000074180
AA Change: A73S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000073811
Gene: ENSMUSG00000096289
AA Change: A73S

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 7.4e-55 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.1e-5 PFAM
Pfam:7tm_1 40 289 3.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207093
AA Change: A73S
Predicted Effect probably benign
Transcript: ENSMUST00000208104
AA Change: A30S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208420
Predicted Effect probably benign
Transcript: ENSMUST00000215567
AA Change: A73S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000216014
AA Change: A73S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000216369
AA Change: A30S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000217451
AA Change: A73S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,554,496 F10I unknown Het
Adad1 G T 3: 37,065,210 A147S probably damaging Het
Atg14 T G 14: 47,545,816 N354T probably damaging Het
Brip1 T A 11: 86,064,980 E902D probably benign Het
Brwd1 A G 16: 96,053,972 S419P probably damaging Het
Camsap3 A G 8: 3,604,244 K638R probably damaging Het
Dennd4c T A 4: 86,795,299 probably null Het
Dnah3 T C 7: 120,071,905 N585S probably benign Het
Eef1akmt2 C A 7: 132,851,489 W38L probably damaging Het
Fasn A T 11: 120,811,908 D1709E probably benign Het
Fbrsl1 T C 5: 110,417,901 D179G probably damaging Het
Fbxl18 A T 5: 142,886,313 I389N probably damaging Het
Fuca1 G T 4: 135,932,926 G252C probably damaging Het
Fut9 T A 4: 25,620,502 H104L probably damaging Het
Glra1 C T 11: 55,536,505 probably null Het
Gpsm1 T C 2: 26,319,996 V45A possibly damaging Het
Hadha A G 5: 30,154,961 probably benign Het
Hddc2 C T 10: 31,327,953 T192I probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Igkv14-100 A G 6: 68,519,399 D92G probably damaging Het
Il17rc T C 6: 113,472,366 V88A possibly damaging Het
Inpp5j T C 11: 3,500,664 D563G probably damaging Het
Lamc3 T A 2: 31,908,669 N462K probably benign Het
Mrpl15 T C 1: 4,784,145 probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Olfr135 T C 17: 38,208,443 L66P probably damaging Het
Psg20 T C 7: 18,674,366 *473W probably null Het
Rimbp3 A G 16: 17,209,807 E365G probably damaging Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Snai2 A G 16: 14,708,189 T235A possibly damaging Het
Tg A T 15: 66,707,930 Y1528F probably damaging Het
Tlr3 A G 8: 45,403,038 V35A probably benign Het
Tnfsf15 T C 4: 63,729,888 I172V probably benign Het
Tns1 G A 1: 73,925,482 T1330I probably damaging Het
Zc3h6 T A 2: 129,010,433 F330I possibly damaging Het
Zdbf2 A G 1: 63,303,650 E396G possibly damaging Het
Other mutations in Olfr1484
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Olfr1484 APN 19 13586104 missense probably benign 0.05
IGL02104:Olfr1484 APN 19 13585604 missense probably damaging 0.99
IGL02502:Olfr1484 APN 19 13585748 missense probably damaging 1.00
IGL03339:Olfr1484 APN 19 13586075 missense probably damaging 0.99
IGL03391:Olfr1484 APN 19 13586119 missense probably benign
R0008:Olfr1484 UTSW 19 13585876 missense probably benign 0.01
R0607:Olfr1484 UTSW 19 13586170 missense probably damaging 1.00
R0892:Olfr1484 UTSW 19 13585517 missense probably damaging 1.00
R1170:Olfr1484 UTSW 19 13586213 missense probably benign 0.00
R1605:Olfr1484 UTSW 19 13585630 missense probably benign 0.00
R1619:Olfr1484 UTSW 19 13585614 missense probably benign 0.03
R1793:Olfr1484 UTSW 19 13585415 missense probably benign 0.42
R2073:Olfr1484 UTSW 19 13585601 missense probably damaging 1.00
R2348:Olfr1484 UTSW 19 13586189 missense probably damaging 0.99
R5383:Olfr1484 UTSW 19 13586075 missense probably damaging 0.99
R5771:Olfr1484 UTSW 19 13585508 missense probably damaging 0.98
R6002:Olfr1484 UTSW 19 13585417 start gained probably benign
R6992:Olfr1484 UTSW 19 13585447 missense possibly damaging 0.57
R7404:Olfr1484 UTSW 19 13585388 missense possibly damaging 0.88
RF002:Olfr1484 UTSW 19 13586051 missense probably damaging 1.00
X0019:Olfr1484 UTSW 19 13586208 missense probably null 0.00
X0019:Olfr1484 UTSW 19 13586209 missense probably damaging 1.00
X0040:Olfr1484 UTSW 19 13586208 missense probably null 0.00
X0040:Olfr1484 UTSW 19 13586209 missense probably damaging 1.00
X0067:Olfr1484 UTSW 19 13586072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGATGCACCATTCCTGC -3'
(R):5'- GTCCACTCAAGTAAGATCCAGCAAG -3'

Sequencing Primer
(F):5'- TGCACCATTCCTGCAAACTC -3'
(R):5'- GCAGGACACATATCGTAGTTGTC -3'
Posted On2016-06-06