Mutagenetix > Incidental Mutation

Incidental Mutation 'R5026:Nvl'

391323

Institutional Source

Beutler Lab

Gene Symbol

Nvl

Ensembl Gene

ENSMUSG00000026516

Gene Name

nuclear VCP-like

Synonyms

1200009I24Rik

MMRRC Submission

042617-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R5026 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

181087138-181144204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 181105155 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 699 (R699H)

Ref Sequence

ENSEMBL: ENSMUSP00000027797 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027797]

AlphaFold

Q9DBY8

PDB Structure

Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027797
AA Change: R699H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516
AA Change: R699H

Domain	Start	End	E-Value	Type
Pfam:Nucleolin_bd	2	72	1.9e-31	PFAM
low complexity region	90	104	N/A	INTRINSIC
low complexity region	187	201	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
AAA	296	435	2.94e-23	SMART
low complexity region	524	540	N/A	INTRINSIC
AAA	613	749	2.56e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191728

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 90.7%

Validation Efficiency

96% (88/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,317,224	N608S	probably benign	Het
Actg1	T	C	11: 120,346,958	N7S	probably damaging	Het
Adamtsl3	T	A	7: 82,576,054	L357Q	probably benign	Het
Ahnak	A	T	19: 9,010,631	Q3093L	possibly damaging	Het
Ankrd16	T	A	2: 11,789,881	V359E	probably benign	Het
Ankrd40	T	C	11: 94,339,724		probably benign	Het
Ano10	G	A	9: 122,272,559	Q49*	probably null	Het
Aoah	A	T	13: 20,914,959	D236V	probably damaging	Het
Bin1	T	C	18: 32,419,930		probably null	Het
Braf	T	C	6: 39,688,287	D49G	probably benign	Het
Brsk1	A	T	7: 4,704,266	R273W	probably damaging	Het
C2cd3	T	A	7: 100,459,842	M2259K	possibly damaging	Het
Cabp1	T	C	5: 115,175,472	N43D	possibly damaging	Het
Ccar2	T	A	14: 70,142,502	Q412L	possibly damaging	Het
Cd4	T	C	6: 124,866,620	T443A	possibly damaging	Het
Cdh23	T	A	10: 60,304,848	I3206F	possibly damaging	Het
Ceacam9	A	T	7: 16,725,197		probably null	Het
Chid1	T	C	7: 141,513,836	D289G	probably damaging	Het
Chmp6	T	A	11: 119,918,643	L196Q	probably damaging	Het
Cog8	A	G	8: 107,049,125	S536P	probably benign	Het
Dmxl2	A	T	9: 54,416,676	S1141R	probably damaging	Het
Dnah7a	T	G	1: 53,662,498	Y166S	probably damaging	Het
Dnah7b	G	T	1: 46,187,363	W1318L	probably damaging	Het
Ecd	A	G	14: 20,337,030	F212S	probably damaging	Het
Entpd6	A	T	2: 150,763,644	S265C	probably damaging	Het
Epb41l2	A	G	10: 25,484,308	T523A	possibly damaging	Het
Focad	T	C	4: 88,344,582	S939P	unknown	Het
Gjb3	A	T	4: 127,326,487	V84D	probably damaging	Het
Gm572	A	T	4: 148,654,844	E43V	possibly damaging	Het
Gm6185	T	A	1: 161,224,608		noncoding transcript	Het
Gria1	T	A	11: 57,310,696	C787S	probably damaging	Het
Grpel2	A	G	18: 61,715,953	L162P	probably damaging	Het
Herc1	A	G	9: 66,486,126	T4096A	probably benign	Het
Hook3	A	T	8: 26,110,757	M41K	probably damaging	Het
Ifit1bl1	T	C	19: 34,593,893	Y388C	probably damaging	Het
Ighv3-4	A	G	12: 114,253,762	Y70H	probably benign	Het
Itm2c	T	C	1: 85,906,492	L176P	probably damaging	Het
Lmtk3	G	A	7: 45,794,412		probably benign	Het
Macf1	G	A	4: 123,439,494	T2376I	possibly damaging	Het
Map1a	T	G	2: 121,307,538	S2660A	possibly damaging	Het
Mmrn2	A	G	14: 34,399,201	H676R	probably benign	Het
Nbeal1	A	T	1: 60,237,179	K693M	probably damaging	Het
Ndufa13	T	A	8: 69,895,270	R49*	probably null	Het
Neb	T	A	2: 52,204,880	T1115S	possibly damaging	Het
Olfr1490	A	G	19: 13,654,932	I163V	probably benign	Het
Olfr74	A	T	2: 87,974,020	I215N	probably damaging	Het
Olfr920	A	G	9: 38,755,745	D19G	probably benign	Het
Olfr926	A	T	9: 38,877,899	H241L	possibly damaging	Het
Piezo1	G	T	8: 122,486,818	D1779E	probably benign	Het
Prl8a9	A	G	13: 27,561,577	S77P	probably damaging	Het
Prune2	A	T	19: 17,199,142	I2904F	probably damaging	Het
Retreg1	T	A	15: 25,970,128	S151T	probably damaging	Het
Rnf213	A	G	11: 119,436,764	D1859G	probably damaging	Het
Rnf39	T	C	17: 36,945,534	F173L	probably benign	Het
Rspry1	T	A	8: 94,650,303	N371K	probably damaging	Het
Samd9l	T	A	6: 3,375,284	D659V	possibly damaging	Het
Sez6	T	A	11: 77,968,989	F378Y	probably damaging	Het
Slc22a19	G	A	19: 7,674,372	T490M	probably benign	Het
Slit2	A	T	5: 48,256,805	N917I	probably damaging	Het
Smg1	T	A	7: 118,193,545		probably benign	Het
Tes	T	C	6: 17,096,340	V24A	probably benign	Het
Tial1	C	T	7: 128,448,396	E82K	probably damaging	Het
Tmem94	G	A	11: 115,793,104	C750Y	probably damaging	Het
Tmppe	T	A	9: 114,405,819	N395K	possibly damaging	Het
Tnn	T	C	1: 160,146,137	H220R	probably benign	Het
Trappc10	T	C	10: 78,204,288	T610A	possibly damaging	Het
Trmt1l	T	A	1: 151,440,876	M196K	probably damaging	Het
Trpv4	T	C	5: 114,622,654	*872W	probably null	Het
Ttn	T	C	2: 76,749,009	T23847A	probably benign	Het
Ube4b	T	A	4: 149,360,565	L440F	probably damaging	Het
Ugt1a5	C	G	1: 88,166,241	R64G	probably benign	Het
Unc13c	T	A	9: 73,930,903	T889S	possibly damaging	Het
Vmn1r215	C	T	13: 23,076,279	T163I	probably benign	Het
Vmn2r16	T	A	5: 109,360,856	Y483*	probably null	Het
Wdr47	T	A	3: 108,618,522	C120*	probably null	Het
Zc3h6	G	A	2: 129,017,309	V1087I	probably benign	Het
Zfp423	T	C	8: 87,780,674	H889R	probably damaging	Het
Zfp825	G	T	13: 74,481,077	H107N	probably benign	Het
Zfp945	T	C	17: 22,850,885	H680R	probably damaging	Het

Other mutations in Nvl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00848:Nvl	APN	1	181105125	missense	probably damaging	1.00
IGL00943:Nvl	APN	1	181101634	missense	possibly damaging	0.72
IGL01956:Nvl	APN	1	181134944	missense	probably benign	0.00
IGL02657:Nvl	APN	1	181106976	missense	probably damaging	1.00
Nineveh	UTSW	1	181136906	missense	probably benign	0.00
nubia	UTSW	1	181112334	missense	probably benign	0.19
IGL03098:Nvl	UTSW	1	181093906	missense	probably benign	0.37
P0047:Nvl	UTSW	1	181112302	missense	probably damaging	1.00
R0003:Nvl	UTSW	1	181114133	missense	probably damaging	1.00
R0114:Nvl	UTSW	1	181120391	missense	probably benign	0.19
R0265:Nvl	UTSW	1	181134830	missense	probably damaging	0.96
R0928:Nvl	UTSW	1	181093902	missense	probably benign	0.00
R1398:Nvl	UTSW	1	181097126	splice site	probably benign
R1470:Nvl	UTSW	1	181139262	missense	probably damaging	1.00
R1470:Nvl	UTSW	1	181139262	missense	probably damaging	1.00
R1529:Nvl	UTSW	1	181109159	critical splice donor site	probably null
R1934:Nvl	UTSW	1	181099128	missense	probably damaging	0.96
R2176:Nvl	UTSW	1	181135074	splice site	probably benign
R2351:Nvl	UTSW	1	181130792	missense	probably benign	0.03
R4415:Nvl	UTSW	1	181105114	missense	probably benign
R4570:Nvl	UTSW	1	181144082	missense	probably benign	0.03
R4720:Nvl	UTSW	1	181101587	missense	probably damaging	1.00
R4888:Nvl	UTSW	1	181117626	missense	probably damaging	1.00
R5507:Nvl	UTSW	1	181135036	missense	probably damaging	0.98
R5785:Nvl	UTSW	1	181139298	missense	probably damaging	1.00
R5983:Nvl	UTSW	1	181136906	missense	probably benign	0.00
R6143:Nvl	UTSW	1	181134995	missense	probably benign	0.01
R6532:Nvl	UTSW	1	181144143	splice site	probably null
R6821:Nvl	UTSW	1	181126970	nonsense	probably null
R7062:Nvl	UTSW	1	181112334	missense	probably benign	0.19
R7247:Nvl	UTSW	1	181112286	critical splice donor site	probably null
R7358:Nvl	UTSW	1	181135036	missense	probably damaging	0.98
R7665:Nvl	UTSW	1	181134944	missense	probably benign	0.18
R7795:Nvl	UTSW	1	181097157	missense	probably benign	0.00
R7931:Nvl	UTSW	1	181109155	splice site	probably benign
R8185:Nvl	UTSW	1	181144174	unclassified	probably benign
R8806:Nvl	UTSW	1	181095054	missense	probably benign	0.01
R8933:Nvl	UTSW	1	181139073	missense	probably benign	0.00
R8975:Nvl	UTSW	1	181130436	missense	probably benign
R9249:Nvl	UTSW	1	181135028	missense	probably damaging	1.00
R9584:Nvl	UTSW	1	181130866	missense	probably benign
R9586:Nvl	UTSW	1	181105070	critical splice donor site	probably null
X0067:Nvl	UTSW	1	181139158	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- GAAACAATTTCATGAGAATCGAAAGA -3'
(R):5'- TCTGGATCCATGCTGCTGCT -3'

Sequencing Primer
(F):5'- GTGAACTGAACACAGGCCCTTTTG -3'
(R):5'- AAGAGCGAATGTGCTCAG -3'

Posted On

2016-06-06