Incidental Mutation 'R5026:Map1a'
ID391328
Institutional Source Beutler Lab
Gene Symbol Map1a
Ensembl Gene ENSMUSG00000027254
Gene Namemicrotubule-associated protein 1 A
SynonymsMtap1, Mtap-1, 6330416M19Rik, Mtap1a
MMRRC Submission 042617-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R5026 (G1)
Quality Score216
Status Validated
Chromosome2
Chromosomal Location121289600-121310832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 121307538 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 2660 (S2660A)
Ref Sequence ENSEMBL: ENSMUSP00000106269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052029] [ENSMUST00000094639] [ENSMUST00000110625] [ENSMUST00000110626] [ENSMUST00000110627] [ENSMUST00000110628] [ENSMUST00000110639]
Predicted Effect probably benign
Transcript: ENSMUST00000052029
SMART Domains Protein: ENSMUSP00000057632
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.8e-110 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094639
AA Change: S2898A

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092223
Gene: ENSMUSG00000027254
AA Change: S2898A

DomainStartEndE-ValueType
Blast:Lactamase_B 286 538 2e-54 BLAST
SCOP:d1eq1a_ 584 699 8e-5 SMART
low complexity region 743 755 N/A INTRINSIC
low complexity region 820 833 N/A INTRINSIC
low complexity region 852 867 N/A INTRINSIC
low complexity region 897 911 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1334 1344 N/A INTRINSIC
low complexity region 1540 1555 N/A INTRINSIC
coiled coil region 1573 1602 N/A INTRINSIC
internal_repeat_1 1616 1726 7.66e-6 PROSPERO
coiled coil region 1747 1771 N/A INTRINSIC
internal_repeat_1 1774 1888 7.66e-6 PROSPERO
low complexity region 2060 2084 N/A INTRINSIC
low complexity region 2121 2133 N/A INTRINSIC
low complexity region 2156 2169 N/A INTRINSIC
low complexity region 2383 2396 N/A INTRINSIC
low complexity region 2436 2460 N/A INTRINSIC
low complexity region 2517 2541 N/A INTRINSIC
low complexity region 2589 2600 N/A INTRINSIC
low complexity region 2662 2682 N/A INTRINSIC
low complexity region 2685 2704 N/A INTRINSIC
low complexity region 2716 2728 N/A INTRINSIC
low complexity region 2766 2790 N/A INTRINSIC
low complexity region 2980 2988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110625
SMART Domains Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110626
SMART Domains Protein: ENSMUSP00000106256
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 1.1e-135 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110627
SMART Domains Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110628
SMART Domains Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 886 3.9e-101 PFAM
low complexity region 1143 1161 N/A INTRINSIC
coiled coil region 1382 1410 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110639
AA Change: S2660A

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106269
Gene: ENSMUSG00000027254
AA Change: S2660A

DomainStartEndE-ValueType
Blast:Lactamase_B 48 300 3e-54 BLAST
SCOP:d1eq1a_ 346 461 1e-4 SMART
low complexity region 505 517 N/A INTRINSIC
low complexity region 582 595 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 659 673 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1096 1106 N/A INTRINSIC
low complexity region 1302 1317 N/A INTRINSIC
coiled coil region 1335 1364 N/A INTRINSIC
internal_repeat_1 1378 1488 5.43e-6 PROSPERO
coiled coil region 1509 1533 N/A INTRINSIC
internal_repeat_1 1536 1650 5.43e-6 PROSPERO
low complexity region 1822 1846 N/A INTRINSIC
low complexity region 1883 1895 N/A INTRINSIC
low complexity region 1918 1931 N/A INTRINSIC
low complexity region 2145 2158 N/A INTRINSIC
low complexity region 2198 2222 N/A INTRINSIC
low complexity region 2279 2303 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
low complexity region 2424 2444 N/A INTRINSIC
low complexity region 2447 2466 N/A INTRINSIC
low complexity region 2478 2490 N/A INTRINSIC
low complexity region 2528 2552 N/A INTRINSIC
low complexity region 2742 2750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133283
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 90.7%
Validation Efficiency 96% (88/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1A heavy chain and LC2 light chain. Expression of this gene is almost exclusively in the brain. Studies of the rat microtubule-associated protein 1A gene suggested a role in early events of spinal cord development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit Purkinje cell degeneration. Mice homozygous for a spontaneous mutation exhibit mild ataxia and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,317,224 N608S probably benign Het
Actg1 T C 11: 120,346,958 N7S probably damaging Het
Adamtsl3 T A 7: 82,576,054 L357Q probably benign Het
Ahnak A T 19: 9,010,631 Q3093L possibly damaging Het
Ankrd16 T A 2: 11,789,881 V359E probably benign Het
Ankrd40 T C 11: 94,339,724 probably benign Het
Ano10 G A 9: 122,272,559 Q49* probably null Het
Aoah A T 13: 20,914,959 D236V probably damaging Het
Bin1 T C 18: 32,419,930 probably null Het
Braf T C 6: 39,688,287 D49G probably benign Het
Brsk1 A T 7: 4,704,266 R273W probably damaging Het
C2cd3 T A 7: 100,459,842 M2259K possibly damaging Het
Cabp1 T C 5: 115,175,472 N43D possibly damaging Het
Ccar2 T A 14: 70,142,502 Q412L possibly damaging Het
Cd4 T C 6: 124,866,620 T443A possibly damaging Het
Cdh23 T A 10: 60,304,848 I3206F possibly damaging Het
Ceacam9 A T 7: 16,725,197 probably null Het
Chid1 T C 7: 141,513,836 D289G probably damaging Het
Chmp6 T A 11: 119,918,643 L196Q probably damaging Het
Cog8 A G 8: 107,049,125 S536P probably benign Het
Dmxl2 A T 9: 54,416,676 S1141R probably damaging Het
Dnah7a T G 1: 53,662,498 Y166S probably damaging Het
Dnah7b G T 1: 46,187,363 W1318L probably damaging Het
Ecd A G 14: 20,337,030 F212S probably damaging Het
Entpd6 A T 2: 150,763,644 S265C probably damaging Het
Epb41l2 A G 10: 25,484,308 T523A possibly damaging Het
Focad T C 4: 88,344,582 S939P unknown Het
Gjb3 A T 4: 127,326,487 V84D probably damaging Het
Gm572 A T 4: 148,654,844 E43V possibly damaging Het
Gm6185 T A 1: 161,224,608 noncoding transcript Het
Gria1 T A 11: 57,310,696 C787S probably damaging Het
Grpel2 A G 18: 61,715,953 L162P probably damaging Het
Herc1 A G 9: 66,486,126 T4096A probably benign Het
Hook3 A T 8: 26,110,757 M41K probably damaging Het
Ifit1bl1 T C 19: 34,593,893 Y388C probably damaging Het
Ighv3-4 A G 12: 114,253,762 Y70H probably benign Het
Itm2c T C 1: 85,906,492 L176P probably damaging Het
Lmtk3 G A 7: 45,794,412 probably benign Het
Macf1 G A 4: 123,439,494 T2376I possibly damaging Het
Mmrn2 A G 14: 34,399,201 H676R probably benign Het
Nbeal1 A T 1: 60,237,179 K693M probably damaging Het
Ndufa13 T A 8: 69,895,270 R49* probably null Het
Neb T A 2: 52,204,880 T1115S possibly damaging Het
Nvl C T 1: 181,105,155 R699H probably damaging Het
Olfr1490 A G 19: 13,654,932 I163V probably benign Het
Olfr74 A T 2: 87,974,020 I215N probably damaging Het
Olfr920 A G 9: 38,755,745 D19G probably benign Het
Olfr926 A T 9: 38,877,899 H241L possibly damaging Het
Piezo1 G T 8: 122,486,818 D1779E probably benign Het
Prl8a9 A G 13: 27,561,577 S77P probably damaging Het
Prune2 A T 19: 17,199,142 I2904F probably damaging Het
Retreg1 T A 15: 25,970,128 S151T probably damaging Het
Rnf213 A G 11: 119,436,764 D1859G probably damaging Het
Rnf39 T C 17: 36,945,534 F173L probably benign Het
Rspry1 T A 8: 94,650,303 N371K probably damaging Het
Samd9l T A 6: 3,375,284 D659V possibly damaging Het
Sez6 T A 11: 77,968,989 F378Y probably damaging Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Slit2 A T 5: 48,256,805 N917I probably damaging Het
Smg1 T A 7: 118,193,545 probably benign Het
Tes T C 6: 17,096,340 V24A probably benign Het
Tial1 C T 7: 128,448,396 E82K probably damaging Het
Tmem94 G A 11: 115,793,104 C750Y probably damaging Het
Tmppe T A 9: 114,405,819 N395K possibly damaging Het
Tnn T C 1: 160,146,137 H220R probably benign Het
Trappc10 T C 10: 78,204,288 T610A possibly damaging Het
Trmt1l T A 1: 151,440,876 M196K probably damaging Het
Trpv4 T C 5: 114,622,654 *872W probably null Het
Ttn T C 2: 76,749,009 T23847A probably benign Het
Ube4b T A 4: 149,360,565 L440F probably damaging Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Unc13c T A 9: 73,930,903 T889S possibly damaging Het
Vmn1r215 C T 13: 23,076,279 T163I probably benign Het
Vmn2r16 T A 5: 109,360,856 Y483* probably null Het
Wdr47 T A 3: 108,618,522 C120* probably null Het
Zc3h6 G A 2: 129,017,309 V1087I probably benign Het
Zfp423 T C 8: 87,780,674 H889R probably damaging Het
Zfp825 G T 13: 74,481,077 H107N probably benign Het
Zfp945 T C 17: 22,850,885 H680R probably damaging Het
Other mutations in Map1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Map1a APN 2 121299027 missense probably damaging 0.99
IGL00826:Map1a APN 2 121302276 missense possibly damaging 0.87
IGL01476:Map1a APN 2 121305207 missense probably damaging 1.00
IGL02029:Map1a APN 2 121303298 missense possibly damaging 0.57
IGL02100:Map1a APN 2 121302846 missense probably damaging 0.99
IGL02136:Map1a APN 2 121300212 missense probably damaging 1.00
IGL02146:Map1a APN 2 121299446 missense probably damaging 1.00
IGL02264:Map1a APN 2 121307313 missense probably damaging 1.00
IGL02456:Map1a APN 2 121298653 missense probably damaging 1.00
IGL02485:Map1a APN 2 121299288 missense probably damaging 1.00
IGL02535:Map1a APN 2 121302177 nonsense probably null
IGL02628:Map1a APN 2 121300104 missense probably damaging 1.00
IGL02721:Map1a APN 2 121304037 missense probably benign 0.44
IGL03273:Map1a APN 2 121300238 missense probably damaging 1.00
IGL03281:Map1a APN 2 121305060 missense probably damaging 1.00
IGL02991:Map1a UTSW 2 121301610 missense probably damaging 0.99
R0096:Map1a UTSW 2 121301505 missense probably damaging 1.00
R0096:Map1a UTSW 2 121301505 missense probably damaging 1.00
R0218:Map1a UTSW 2 121305425 missense probably benign 0.00
R0363:Map1a UTSW 2 121302044 missense probably damaging 1.00
R0450:Map1a UTSW 2 121305774 missense probably benign 0.27
R0469:Map1a UTSW 2 121305774 missense probably benign 0.27
R0477:Map1a UTSW 2 121302101 missense probably damaging 1.00
R0504:Map1a UTSW 2 121302941 missense probably benign 0.03
R0510:Map1a UTSW 2 121305774 missense probably benign 0.27
R0521:Map1a UTSW 2 121305753 missense probably damaging 1.00
R0601:Map1a UTSW 2 121298602 missense probably damaging 1.00
R0619:Map1a UTSW 2 121305255 missense probably damaging 0.96
R0633:Map1a UTSW 2 121308014 missense probably damaging 1.00
R0652:Map1a UTSW 2 121302783 missense probably benign 0.04
R0893:Map1a UTSW 2 121300533 missense probably damaging 1.00
R0960:Map1a UTSW 2 121301643 missense probably benign 0.16
R1115:Map1a UTSW 2 121307378 splice site probably null
R1166:Map1a UTSW 2 121300260 missense probably damaging 1.00
R1326:Map1a UTSW 2 121306190 nonsense probably null
R1331:Map1a UTSW 2 121306220 nonsense probably null
R1395:Map1a UTSW 2 121303925 missense probably benign 0.26
R1489:Map1a UTSW 2 121300437 missense possibly damaging 0.91
R1573:Map1a UTSW 2 121304126 missense probably benign 0.37
R1596:Map1a UTSW 2 121289765 missense probably benign 0.00
R1662:Map1a UTSW 2 121306408 missense possibly damaging 0.90
R1675:Map1a UTSW 2 121302655 nonsense probably null
R1919:Map1a UTSW 2 121307012 missense probably damaging 1.00
R2122:Map1a UTSW 2 121299446 missense probably damaging 1.00
R2126:Map1a UTSW 2 121298641 missense probably damaging 0.96
R2143:Map1a UTSW 2 121301945 missense probably damaging 1.00
R2172:Map1a UTSW 2 121307932 missense probably damaging 1.00
R2249:Map1a UTSW 2 121300287 missense probably damaging 1.00
R2254:Map1a UTSW 2 121303791 missense possibly damaging 0.71
R2255:Map1a UTSW 2 121303791 missense possibly damaging 0.71
R3834:Map1a UTSW 2 121307322 missense probably damaging 1.00
R4011:Map1a UTSW 2 121300127 missense probably damaging 1.00
R4346:Map1a UTSW 2 121301325 missense probably benign 0.13
R4842:Map1a UTSW 2 121302086 missense probably damaging 1.00
R4933:Map1a UTSW 2 121305905 missense probably damaging 1.00
R4978:Map1a UTSW 2 121301142 missense probably benign 0.00
R4988:Map1a UTSW 2 121303050 missense probably benign 0.34
R5086:Map1a UTSW 2 121304504 missense probably damaging 1.00
R5155:Map1a UTSW 2 121302386 missense probably damaging 1.00
R5232:Map1a UTSW 2 121301985 missense probably damaging 1.00
R5311:Map1a UTSW 2 121302387 missense probably damaging 1.00
R5401:Map1a UTSW 2 121299672 missense probably damaging 1.00
R5465:Map1a UTSW 2 121306025 missense probably damaging 1.00
R5526:Map1a UTSW 2 121305662 missense probably damaging 1.00
R5642:Map1a UTSW 2 121306043 missense probably damaging 1.00
R5726:Map1a UTSW 2 121305065 missense probably damaging 1.00
R5817:Map1a UTSW 2 121298910 missense possibly damaging 0.81
R5855:Map1a UTSW 2 121303674 missense possibly damaging 0.74
R5917:Map1a UTSW 2 121305216 missense probably damaging 1.00
R5974:Map1a UTSW 2 121304376 missense probably benign 0.20
R5987:Map1a UTSW 2 121304295 missense possibly damaging 0.56
R6151:Map1a UTSW 2 121289823 missense probably benign 0.12
R6406:Map1a UTSW 2 121300743 missense probably damaging 1.00
R7014:Map1a UTSW 2 121300239 missense probably damaging 1.00
R7099:Map1a UTSW 2 121300517 missense probably benign 0.04
R7211:Map1a UTSW 2 121304643 missense probably benign 0.02
R7230:Map1a UTSW 2 121300818 missense probably damaging 1.00
R7305:Map1a UTSW 2 121299458 missense probably damaging 1.00
R7382:Map1a UTSW 2 121290785 missense probably damaging 1.00
R7524:Map1a UTSW 2 121289812 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTAGTCAATGGCCTCAAG -3'
(R):5'- GTCTCCTGCTACTCACCTGAAG -3'

Sequencing Primer
(F):5'- TCAAGGCAGGATCCAGTGAGTATATC -3'
(R):5'- CACATAGTAGGATGCACG -3'
Posted On2016-06-06