Mutagenetix > Incidental Mutation

Incidental Mutation 'R5026:Zc3h6'

391329

Institutional Source

Beutler Lab

Gene Symbol

Zc3h6

Ensembl Gene

ENSMUSG00000042851

Gene Name

zinc finger CCCH type containing 6

Synonyms

MMRRC Submission

042617-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.214) question?

Stock #

R5026 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128967402-129018563 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 129017309 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1087 (V1087I)

Ref Sequence

ENSEMBL: ENSMUSP00000105949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110320]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110320
AA Change: V1087I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: V1087I

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
coiled coil region	30	71	N/A	INTRINSIC
low complexity region	74	88	N/A	INTRINSIC
low complexity region	177	192	N/A	INTRINSIC
ZnF_C3H1	271	296	1.72e-4	SMART
ZnF_C3H1	300	325	2.51e-6	SMART
ZnF_C3H1	326	349	5.24e0	SMART
coiled coil region	351	383	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	493	509	N/A	INTRINSIC
low complexity region	698	707	N/A	INTRINSIC
low complexity region	784	798	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
low complexity region	876	890	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135186

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 90.7%

Validation Efficiency

96% (88/92)

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,317,224	N608S	probably benign	Het
Actg1	T	C	11: 120,346,958	N7S	probably damaging	Het
Adamtsl3	T	A	7: 82,576,054	L357Q	probably benign	Het
Ahnak	A	T	19: 9,010,631	Q3093L	possibly damaging	Het
Ankrd16	T	A	2: 11,789,881	V359E	probably benign	Het
Ankrd40	T	C	11: 94,339,724		probably benign	Het
Ano10	G	A	9: 122,272,559	Q49*	probably null	Het
Aoah	A	T	13: 20,914,959	D236V	probably damaging	Het
Bin1	T	C	18: 32,419,930		probably null	Het
Braf	T	C	6: 39,688,287	D49G	probably benign	Het
Brsk1	A	T	7: 4,704,266	R273W	probably damaging	Het
C2cd3	T	A	7: 100,459,842	M2259K	possibly damaging	Het
Cabp1	T	C	5: 115,175,472	N43D	possibly damaging	Het
Ccar2	T	A	14: 70,142,502	Q412L	possibly damaging	Het
Cd4	T	C	6: 124,866,620	T443A	possibly damaging	Het
Cdh23	T	A	10: 60,304,848	I3206F	possibly damaging	Het
Ceacam9	A	T	7: 16,725,197		probably null	Het
Chid1	T	C	7: 141,513,836	D289G	probably damaging	Het
Chmp6	T	A	11: 119,918,643	L196Q	probably damaging	Het
Cog8	A	G	8: 107,049,125	S536P	probably benign	Het
Dmxl2	A	T	9: 54,416,676	S1141R	probably damaging	Het
Dnah7a	T	G	1: 53,662,498	Y166S	probably damaging	Het
Dnah7b	G	T	1: 46,187,363	W1318L	probably damaging	Het
Ecd	A	G	14: 20,337,030	F212S	probably damaging	Het
Entpd6	A	T	2: 150,763,644	S265C	probably damaging	Het
Epb41l2	A	G	10: 25,484,308	T523A	possibly damaging	Het
Focad	T	C	4: 88,344,582	S939P	unknown	Het
Gjb3	A	T	4: 127,326,487	V84D	probably damaging	Het
Gm572	A	T	4: 148,654,844	E43V	possibly damaging	Het
Gm6185	T	A	1: 161,224,608		noncoding transcript	Het
Gria1	T	A	11: 57,310,696	C787S	probably damaging	Het
Grpel2	A	G	18: 61,715,953	L162P	probably damaging	Het
Herc1	A	G	9: 66,486,126	T4096A	probably benign	Het
Hook3	A	T	8: 26,110,757	M41K	probably damaging	Het
Ifit1bl1	T	C	19: 34,593,893	Y388C	probably damaging	Het
Ighv3-4	A	G	12: 114,253,762	Y70H	probably benign	Het
Itm2c	T	C	1: 85,906,492	L176P	probably damaging	Het
Lmtk3	G	A	7: 45,794,412		probably benign	Het
Macf1	G	A	4: 123,439,494	T2376I	possibly damaging	Het
Map1a	T	G	2: 121,307,538	S2660A	possibly damaging	Het
Mmrn2	A	G	14: 34,399,201	H676R	probably benign	Het
Nbeal1	A	T	1: 60,237,179	K693M	probably damaging	Het
Ndufa13	T	A	8: 69,895,270	R49*	probably null	Het
Neb	T	A	2: 52,204,880	T1115S	possibly damaging	Het
Nvl	C	T	1: 181,105,155	R699H	probably damaging	Het
Olfr1490	A	G	19: 13,654,932	I163V	probably benign	Het
Olfr74	A	T	2: 87,974,020	I215N	probably damaging	Het
Olfr920	A	G	9: 38,755,745	D19G	probably benign	Het
Olfr926	A	T	9: 38,877,899	H241L	possibly damaging	Het
Piezo1	G	T	8: 122,486,818	D1779E	probably benign	Het
Prl8a9	A	G	13: 27,561,577	S77P	probably damaging	Het
Prune2	A	T	19: 17,199,142	I2904F	probably damaging	Het
Retreg1	T	A	15: 25,970,128	S151T	probably damaging	Het
Rnf213	A	G	11: 119,436,764	D1859G	probably damaging	Het
Rnf39	T	C	17: 36,945,534	F173L	probably benign	Het
Rspry1	T	A	8: 94,650,303	N371K	probably damaging	Het
Samd9l	T	A	6: 3,375,284	D659V	possibly damaging	Het
Sez6	T	A	11: 77,968,989	F378Y	probably damaging	Het
Slc22a19	G	A	19: 7,674,372	T490M	probably benign	Het
Slit2	A	T	5: 48,256,805	N917I	probably damaging	Het
Smg1	T	A	7: 118,193,545		probably benign	Het
Tes	T	C	6: 17,096,340	V24A	probably benign	Het
Tial1	C	T	7: 128,448,396	E82K	probably damaging	Het
Tmem94	G	A	11: 115,793,104	C750Y	probably damaging	Het
Tmppe	T	A	9: 114,405,819	N395K	possibly damaging	Het
Tnn	T	C	1: 160,146,137	H220R	probably benign	Het
Trappc10	T	C	10: 78,204,288	T610A	possibly damaging	Het
Trmt1l	T	A	1: 151,440,876	M196K	probably damaging	Het
Trpv4	T	C	5: 114,622,654	*872W	probably null	Het
Ttn	T	C	2: 76,749,009	T23847A	probably benign	Het
Ube4b	T	A	4: 149,360,565	L440F	probably damaging	Het
Ugt1a5	C	G	1: 88,166,241	R64G	probably benign	Het
Unc13c	T	A	9: 73,930,903	T889S	possibly damaging	Het
Vmn1r215	C	T	13: 23,076,279	T163I	probably benign	Het
Vmn2r16	T	A	5: 109,360,856	Y483*	probably null	Het
Wdr47	T	A	3: 108,618,522	C120*	probably null	Het
Zfp423	T	C	8: 87,780,674	H889R	probably damaging	Het
Zfp825	G	T	13: 74,481,077	H107N	probably benign	Het
Zfp945	T	C	17: 22,850,885	H680R	probably damaging	Het

Other mutations in Zc3h6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01732:Zc3h6	APN	2	129011875	missense	probably damaging	1.00
IGL01880:Zc3h6	APN	2	129017378	missense	probably damaging	0.99
IGL02160:Zc3h6	APN	2	128997685	missense	probably benign	0.02
IGL02161:Zc3h6	APN	2	128993226	missense	possibly damaging	0.90
IGL02202:Zc3h6	APN	2	129016581	missense	probably damaging	1.00
IGL02547:Zc3h6	APN	2	129015611	missense	probably benign	0.00
IGL02973:Zc3h6	APN	2	128997795	missense	probably damaging	0.98
BB001:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
BB011:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R0336:Zc3h6	UTSW	2	129015412	missense	possibly damaging	0.81
R0420:Zc3h6	UTSW	2	129014827	missense	probably benign	0.00
R0538:Zc3h6	UTSW	2	129017223	missense	possibly damaging	0.75
R0944:Zc3h6	UTSW	2	129006816	missense	probably damaging	1.00
R1151:Zc3h6	UTSW	2	129017136	missense	probably benign	0.00
R1528:Zc3h6	UTSW	2	129017069	missense	probably benign	0.01
R1698:Zc3h6	UTSW	2	129017358	missense	probably benign
R1712:Zc3h6	UTSW	2	129016734	missense	probably damaging	1.00
R1913:Zc3h6	UTSW	2	129016620	missense	probably damaging	1.00
R1926:Zc3h6	UTSW	2	128997795	missense	probably damaging	0.98
R2030:Zc3h6	UTSW	2	129006086	missense	probably damaging	1.00
R2051:Zc3h6	UTSW	2	129015618	missense	possibly damaging	0.55
R2133:Zc3h6	UTSW	2	128967830	missense	possibly damaging	0.53
R2273:Zc3h6	UTSW	2	129014709	missense	probably benign	0.01
R2328:Zc3h6	UTSW	2	128993202	missense	possibly damaging	0.85
R2862:Zc3h6	UTSW	2	129015460	missense	probably benign	0.43
R2899:Zc3h6	UTSW	2	129002232	missense	probably benign	0.00
R3711:Zc3h6	UTSW	2	129017331	missense	probably benign	0.00
R3743:Zc3h6	UTSW	2	128997792	missense	probably damaging	1.00
R3893:Zc3h6	UTSW	2	129016140	missense	probably damaging	1.00
R4748:Zc3h6	UTSW	2	129002240	missense	probably damaging	1.00
R5025:Zc3h6	UTSW	2	129010433	missense	possibly damaging	0.87
R5125:Zc3h6	UTSW	2	129014479	missense	possibly damaging	0.93
R5373:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5374:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5703:Zc3h6	UTSW	2	128993452	intron	probably benign
R5802:Zc3h6	UTSW	2	129015559	missense	possibly damaging	0.56
R5876:Zc3h6	UTSW	2	128993277	missense	probably benign	0.29
R5879:Zc3h6	UTSW	2	128997776	splice site	probably null
R5950:Zc3h6	UTSW	2	128997790	nonsense	probably null
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6781:Zc3h6	UTSW	2	129015421	missense	probably damaging	0.99
R7323:Zc3h6	UTSW	2	128993411	missense	unknown
R7340:Zc3h6	UTSW	2	128993190	missense	possibly damaging	0.90
R7572:Zc3h6	UTSW	2	129017252	missense	probably benign	0.02
R7576:Zc3h6	UTSW	2	129014553	missense	probably damaging	1.00
R7797:Zc3h6	UTSW	2	129015635	critical splice donor site	probably null
R7924:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R8048:Zc3h6	UTSW	2	129017014	missense	probably benign	0.30
R8877:Zc3h6	UTSW	2	129014399	nonsense	probably null
R9076:Zc3h6	UTSW	2	129017176	nonsense	probably null
R9577:Zc3h6	UTSW	2	129016182	missense
R9687:Zc3h6	UTSW	2	129017361	missense	probably damaging	1.00
R9745:Zc3h6	UTSW	2	129017235	missense	probably benign	0.08
Z1176:Zc3h6	UTSW	2	129016221	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTCACAGTCCTCAACAGCAG -3'
(R):5'- TGCCTTGGATCACTGTATGG -3'

Sequencing Primer
(F):5'- CTCAACAGCAGCACCTATTAATGTTG -3'
(R):5'- TCACTGTATGGAGGTCTAAGTAAGCC -3'

Posted On

2016-06-06