Incidental Mutation 'R5026:Brsk1'
ID391345
Institutional Source Beutler Lab
Gene Symbol Brsk1
Ensembl Gene ENSMUSG00000035390
Gene NameBR serine/threonine kinase 1
SynonymsSAD-B, LOC381979
MMRRC Submission 042617-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5026 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4690604-4715997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4704266 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 273 (R273W)
Ref Sequence ENSEMBL: ENSMUSP00000145970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048248] [ENSMUST00000086364] [ENSMUST00000120836] [ENSMUST00000205666] [ENSMUST00000206024]
Predicted Effect probably damaging
Transcript: ENSMUST00000048248
AA Change: R273W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039517
Gene: ENSMUSG00000035390
AA Change: R273W

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 13 30 N/A INTRINSIC
S_TKc 34 285 6.75e-103 SMART
low complexity region 330 344 N/A INTRINSIC
low complexity region 430 457 N/A INTRINSIC
low complexity region 492 517 N/A INTRINSIC
low complexity region 523 552 N/A INTRINSIC
low complexity region 668 686 N/A INTRINSIC
low complexity region 746 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086364
SMART Domains Protein: ENSMUSP00000083550
Gene: ENSMUSG00000046456

DomainStartEndE-ValueType
Pfam:Frag1 4 114 1.5e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120836
AA Change: R198W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113448
Gene: ENSMUSG00000035390
AA Change: R198W

DomainStartEndE-ValueType
S_TKc 1 210 1.19e-71 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 355 382 N/A INTRINSIC
low complexity region 417 442 N/A INTRINSIC
low complexity region 448 477 N/A INTRINSIC
low complexity region 593 611 N/A INTRINSIC
low complexity region 671 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123637
Predicted Effect probably damaging
Transcript: ENSMUST00000205666
AA Change: R237W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206024
AA Change: R273W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9614 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 90.7%
Validation Efficiency 96% (88/92)
MGI Phenotype PHENOTYPE: Homozygous mutant mice are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,317,224 N608S probably benign Het
Actg1 T C 11: 120,346,958 N7S probably damaging Het
Adamtsl3 T A 7: 82,576,054 L357Q probably benign Het
Ahnak A T 19: 9,010,631 Q3093L possibly damaging Het
Ankrd16 T A 2: 11,789,881 V359E probably benign Het
Ankrd40 T C 11: 94,339,724 probably benign Het
Ano10 G A 9: 122,272,559 Q49* probably null Het
Aoah A T 13: 20,914,959 D236V probably damaging Het
Bin1 T C 18: 32,419,930 probably null Het
Braf T C 6: 39,688,287 D49G probably benign Het
C2cd3 T A 7: 100,459,842 M2259K possibly damaging Het
Cabp1 T C 5: 115,175,472 N43D possibly damaging Het
Ccar2 T A 14: 70,142,502 Q412L possibly damaging Het
Cd4 T C 6: 124,866,620 T443A possibly damaging Het
Cdh23 T A 10: 60,304,848 I3206F possibly damaging Het
Ceacam9 A T 7: 16,725,197 probably null Het
Chid1 T C 7: 141,513,836 D289G probably damaging Het
Chmp6 T A 11: 119,918,643 L196Q probably damaging Het
Cog8 A G 8: 107,049,125 S536P probably benign Het
Dmxl2 A T 9: 54,416,676 S1141R probably damaging Het
Dnah7a T G 1: 53,662,498 Y166S probably damaging Het
Dnah7b G T 1: 46,187,363 W1318L probably damaging Het
Ecd A G 14: 20,337,030 F212S probably damaging Het
Entpd6 A T 2: 150,763,644 S265C probably damaging Het
Epb41l2 A G 10: 25,484,308 T523A possibly damaging Het
Focad T C 4: 88,344,582 S939P unknown Het
Gjb3 A T 4: 127,326,487 V84D probably damaging Het
Gm572 A T 4: 148,654,844 E43V possibly damaging Het
Gm6185 T A 1: 161,224,608 noncoding transcript Het
Gria1 T A 11: 57,310,696 C787S probably damaging Het
Grpel2 A G 18: 61,715,953 L162P probably damaging Het
Herc1 A G 9: 66,486,126 T4096A probably benign Het
Hook3 A T 8: 26,110,757 M41K probably damaging Het
Ifit1bl1 T C 19: 34,593,893 Y388C probably damaging Het
Ighv3-4 A G 12: 114,253,762 Y70H probably benign Het
Itm2c T C 1: 85,906,492 L176P probably damaging Het
Lmtk3 G A 7: 45,794,412 probably benign Het
Macf1 G A 4: 123,439,494 T2376I possibly damaging Het
Map1a T G 2: 121,307,538 S2660A possibly damaging Het
Mmrn2 A G 14: 34,399,201 H676R probably benign Het
Nbeal1 A T 1: 60,237,179 K693M probably damaging Het
Ndufa13 T A 8: 69,895,270 R49* probably null Het
Neb T A 2: 52,204,880 T1115S possibly damaging Het
Nvl C T 1: 181,105,155 R699H probably damaging Het
Olfr1490 A G 19: 13,654,932 I163V probably benign Het
Olfr74 A T 2: 87,974,020 I215N probably damaging Het
Olfr920 A G 9: 38,755,745 D19G probably benign Het
Olfr926 A T 9: 38,877,899 H241L possibly damaging Het
Piezo1 G T 8: 122,486,818 D1779E probably benign Het
Prl8a9 A G 13: 27,561,577 S77P probably damaging Het
Prune2 A T 19: 17,199,142 I2904F probably damaging Het
Retreg1 T A 15: 25,970,128 S151T probably damaging Het
Rnf213 A G 11: 119,436,764 D1859G probably damaging Het
Rnf39 T C 17: 36,945,534 F173L probably benign Het
Rspry1 T A 8: 94,650,303 N371K probably damaging Het
Samd9l T A 6: 3,375,284 D659V possibly damaging Het
Sez6 T A 11: 77,968,989 F378Y probably damaging Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Slit2 A T 5: 48,256,805 N917I probably damaging Het
Smg1 T A 7: 118,193,545 probably benign Het
Tes T C 6: 17,096,340 V24A probably benign Het
Tial1 C T 7: 128,448,396 E82K probably damaging Het
Tmem94 G A 11: 115,793,104 C750Y probably damaging Het
Tmppe T A 9: 114,405,819 N395K possibly damaging Het
Tnn T C 1: 160,146,137 H220R probably benign Het
Trappc10 T C 10: 78,204,288 T610A possibly damaging Het
Trmt1l T A 1: 151,440,876 M196K probably damaging Het
Trpv4 T C 5: 114,622,654 *872W probably null Het
Ttn T C 2: 76,749,009 T23847A probably benign Het
Ube4b T A 4: 149,360,565 L440F probably damaging Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Unc13c T A 9: 73,930,903 T889S possibly damaging Het
Vmn1r215 C T 13: 23,076,279 T163I probably benign Het
Vmn2r16 T A 5: 109,360,856 Y483* probably null Het
Wdr47 T A 3: 108,618,522 C120* probably null Het
Zc3h6 G A 2: 129,017,309 V1087I probably benign Het
Zfp423 T C 8: 87,780,674 H889R probably damaging Het
Zfp825 G T 13: 74,481,077 H107N probably benign Het
Zfp945 T C 17: 22,850,885 H680R probably damaging Het
Other mutations in Brsk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Brsk1 APN 7 4704261 missense probably benign 0.03
IGL01733:Brsk1 APN 7 4706072 missense probably damaging 1.00
IGL03019:Brsk1 APN 7 4710497 intron probably benign
IGL03088:Brsk1 APN 7 4710454 intron probably benign
R0612:Brsk1 UTSW 7 4707426 missense possibly damaging 0.96
R0891:Brsk1 UTSW 7 4704227 missense possibly damaging 0.95
R1455:Brsk1 UTSW 7 4704251 missense probably damaging 1.00
R1728:Brsk1 UTSW 7 4704219 missense probably damaging 1.00
R2884:Brsk1 UTSW 7 4691123 unclassified probably benign
R2939:Brsk1 UTSW 7 4708140 missense possibly damaging 0.53
R4392:Brsk1 UTSW 7 4698750 missense probably damaging 1.00
R4661:Brsk1 UTSW 7 4707299 missense possibly damaging 0.73
R4662:Brsk1 UTSW 7 4707299 missense possibly damaging 0.73
R4756:Brsk1 UTSW 7 4708867 missense possibly damaging 0.72
R4788:Brsk1 UTSW 7 4698955 splice site probably null
R5248:Brsk1 UTSW 7 4708866 missense possibly damaging 0.53
R5267:Brsk1 UTSW 7 4704709 missense probably damaging 1.00
R5419:Brsk1 UTSW 7 4709004 missense possibly damaging 0.53
R5430:Brsk1 UTSW 7 4710436 missense probably benign 0.00
R5625:Brsk1 UTSW 7 4706400 missense probably damaging 1.00
R5659:Brsk1 UTSW 7 4715372 missense possibly damaging 0.93
R6700:Brsk1 UTSW 7 4692701 missense probably damaging 0.99
R6866:Brsk1 UTSW 7 4706407 missense probably damaging 0.98
R7169:Brsk1 UTSW 7 4715404 missense probably benign
Z1088:Brsk1 UTSW 7 4707372 missense possibly damaging 0.96
Z1177:Brsk1 UTSW 7 4704222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGAGAATCACTGACCTGAGG -3'
(R):5'- AAGTGCCAGCCTTTCAACCC -3'

Sequencing Primer
(F):5'- AGAATCACTGACCTGAGGCTCTTG -3'
(R):5'- AATGCGCCGCCCTCAAG -3'
Posted On2016-06-06