Incidental Mutation 'R5026:C2cd3'
ID391350
Institutional Source Beutler Lab
Gene Symbol C2cd3
Ensembl Gene ENSMUSG00000047248
Gene NameC2 calcium-dependent domain containing 3
Synonyms
MMRRC Submission 042617-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5026 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100372233-100470152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100459842 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 2259 (M2259K)
Ref Sequence ENSEMBL: ENSMUSP00000062637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051777
AA Change: M2259K

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: M2259K

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098259
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120196
SMART Domains Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
low complexity region 297 308 N/A INTRINSIC
C2 415 553 1.5e-1 SMART
C2 681 790 2.4e-2 SMART
C2 880 1020 9.5e-2 SMART
C2 1073 1212 1.1e-1 SMART
C2 1508 1615 9e-5 SMART
low complexity region 1783 1797 N/A INTRINSIC
low complexity region 1928 1940 N/A INTRINSIC
low complexity region 2001 2016 N/A INTRINSIC
low complexity region 2071 2087 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193553
Meta Mutation Damage Score 0.1028 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 90.7%
Validation Efficiency 96% (88/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,317,224 N608S probably benign Het
Actg1 T C 11: 120,346,958 N7S probably damaging Het
Adamtsl3 T A 7: 82,576,054 L357Q probably benign Het
Ahnak A T 19: 9,010,631 Q3093L possibly damaging Het
Ankrd16 T A 2: 11,789,881 V359E probably benign Het
Ankrd40 T C 11: 94,339,724 probably benign Het
Ano10 G A 9: 122,272,559 Q49* probably null Het
Aoah A T 13: 20,914,959 D236V probably damaging Het
Bin1 T C 18: 32,419,930 probably null Het
Braf T C 6: 39,688,287 D49G probably benign Het
Brsk1 A T 7: 4,704,266 R273W probably damaging Het
Cabp1 T C 5: 115,175,472 N43D possibly damaging Het
Ccar2 T A 14: 70,142,502 Q412L possibly damaging Het
Cd4 T C 6: 124,866,620 T443A possibly damaging Het
Cdh23 T A 10: 60,304,848 I3206F possibly damaging Het
Ceacam9 A T 7: 16,725,197 probably null Het
Chid1 T C 7: 141,513,836 D289G probably damaging Het
Chmp6 T A 11: 119,918,643 L196Q probably damaging Het
Cog8 A G 8: 107,049,125 S536P probably benign Het
Dmxl2 A T 9: 54,416,676 S1141R probably damaging Het
Dnah7a T G 1: 53,662,498 Y166S probably damaging Het
Dnah7b G T 1: 46,187,363 W1318L probably damaging Het
Ecd A G 14: 20,337,030 F212S probably damaging Het
Entpd6 A T 2: 150,763,644 S265C probably damaging Het
Epb41l2 A G 10: 25,484,308 T523A possibly damaging Het
Focad T C 4: 88,344,582 S939P unknown Het
Gjb3 A T 4: 127,326,487 V84D probably damaging Het
Gm572 A T 4: 148,654,844 E43V possibly damaging Het
Gm6185 T A 1: 161,224,608 noncoding transcript Het
Gria1 T A 11: 57,310,696 C787S probably damaging Het
Grpel2 A G 18: 61,715,953 L162P probably damaging Het
Herc1 A G 9: 66,486,126 T4096A probably benign Het
Hook3 A T 8: 26,110,757 M41K probably damaging Het
Ifit1bl1 T C 19: 34,593,893 Y388C probably damaging Het
Ighv3-4 A G 12: 114,253,762 Y70H probably benign Het
Itm2c T C 1: 85,906,492 L176P probably damaging Het
Lmtk3 G A 7: 45,794,412 probably benign Het
Macf1 G A 4: 123,439,494 T2376I possibly damaging Het
Map1a T G 2: 121,307,538 S2660A possibly damaging Het
Mmrn2 A G 14: 34,399,201 H676R probably benign Het
Nbeal1 A T 1: 60,237,179 K693M probably damaging Het
Ndufa13 T A 8: 69,895,270 R49* probably null Het
Neb T A 2: 52,204,880 T1115S possibly damaging Het
Nvl C T 1: 181,105,155 R699H probably damaging Het
Olfr1490 A G 19: 13,654,932 I163V probably benign Het
Olfr74 A T 2: 87,974,020 I215N probably damaging Het
Olfr920 A G 9: 38,755,745 D19G probably benign Het
Olfr926 A T 9: 38,877,899 H241L possibly damaging Het
Piezo1 G T 8: 122,486,818 D1779E probably benign Het
Prl8a9 A G 13: 27,561,577 S77P probably damaging Het
Prune2 A T 19: 17,199,142 I2904F probably damaging Het
Retreg1 T A 15: 25,970,128 S151T probably damaging Het
Rnf213 A G 11: 119,436,764 D1859G probably damaging Het
Rnf39 T C 17: 36,945,534 F173L probably benign Het
Rspry1 T A 8: 94,650,303 N371K probably damaging Het
Samd9l T A 6: 3,375,284 D659V possibly damaging Het
Sez6 T A 11: 77,968,989 F378Y probably damaging Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Slit2 A T 5: 48,256,805 N917I probably damaging Het
Smg1 T A 7: 118,193,545 probably benign Het
Tes T C 6: 17,096,340 V24A probably benign Het
Tial1 C T 7: 128,448,396 E82K probably damaging Het
Tmem94 G A 11: 115,793,104 C750Y probably damaging Het
Tmppe T A 9: 114,405,819 N395K possibly damaging Het
Tnn T C 1: 160,146,137 H220R probably benign Het
Trappc10 T C 10: 78,204,288 T610A possibly damaging Het
Trmt1l T A 1: 151,440,876 M196K probably damaging Het
Trpv4 T C 5: 114,622,654 *872W probably null Het
Ttn T C 2: 76,749,009 T23847A probably benign Het
Ube4b T A 4: 149,360,565 L440F probably damaging Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Unc13c T A 9: 73,930,903 T889S possibly damaging Het
Vmn1r215 C T 13: 23,076,279 T163I probably benign Het
Vmn2r16 T A 5: 109,360,856 Y483* probably null Het
Wdr47 T A 3: 108,618,522 C120* probably null Het
Zc3h6 G A 2: 129,017,309 V1087I probably benign Het
Zfp423 T C 8: 87,780,674 H889R probably damaging Het
Zfp825 G T 13: 74,481,077 H107N probably benign Het
Zfp945 T C 17: 22,850,885 H680R probably damaging Het
Other mutations in C2cd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:C2cd3 APN 7 100391128 missense probably benign 0.14
IGL01420:C2cd3 APN 7 100454858 missense probably benign 0.35
IGL01775:C2cd3 APN 7 100443431 missense probably damaging 1.00
IGL01832:C2cd3 APN 7 100427214 missense possibly damaging 0.94
IGL01883:C2cd3 APN 7 100374486 missense possibly damaging 0.80
IGL02664:C2cd3 APN 7 100419715 missense possibly damaging 0.67
IGL02697:C2cd3 APN 7 100427169 unclassified probably benign
IGL02852:C2cd3 APN 7 100430189 missense probably damaging 1.00
IGL03158:C2cd3 APN 7 100374476 missense probably damaging 1.00
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0124:C2cd3 UTSW 7 100469518 missense probably benign
R0387:C2cd3 UTSW 7 100422507 splice site probably benign
R0522:C2cd3 UTSW 7 100395222 missense probably benign 0.14
R1124:C2cd3 UTSW 7 100422681 missense probably benign 0.00
R1484:C2cd3 UTSW 7 100440190 missense probably damaging 1.00
R1533:C2cd3 UTSW 7 100406077 missense possibly damaging 0.54
R1631:C2cd3 UTSW 7 100372497 critical splice donor site probably null
R1875:C2cd3 UTSW 7 100407025 missense possibly damaging 0.89
R2059:C2cd3 UTSW 7 100455493 unclassified probably benign
R2060:C2cd3 UTSW 7 100454948 missense probably damaging 1.00
R2348:C2cd3 UTSW 7 100413366 missense probably damaging 1.00
R3103:C2cd3 UTSW 7 100395252 missense possibly damaging 0.47
R3405:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R3687:C2cd3 UTSW 7 100435833 missense probably benign 0.28
R3775:C2cd3 UTSW 7 100431998 missense probably damaging 1.00
R3854:C2cd3 UTSW 7 100454601 critical splice acceptor site probably null
R4359:C2cd3 UTSW 7 100441089 missense probably damaging 1.00
R4403:C2cd3 UTSW 7 100432099 missense probably damaging 1.00
R4446:C2cd3 UTSW 7 100374477 missense probably damaging 1.00
R4646:C2cd3 UTSW 7 100372450 unclassified probably benign
R4705:C2cd3 UTSW 7 100395188 missense possibly damaging 0.77
R4770:C2cd3 UTSW 7 100443435 missense probably damaging 1.00
R4777:C2cd3 UTSW 7 100416332 missense possibly damaging 0.46
R4816:C2cd3 UTSW 7 100391019 missense probably benign 0.01
R4842:C2cd3 UTSW 7 100416190 missense probably benign 0.00
R4858:C2cd3 UTSW 7 100454953 missense probably damaging 1.00
R4871:C2cd3 UTSW 7 100413374 missense possibly damaging 0.79
R4898:C2cd3 UTSW 7 100405959 missense probably damaging 1.00
R5112:C2cd3 UTSW 7 100443485 missense possibly damaging 0.91
R5242:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R5538:C2cd3 UTSW 7 100455493 critical splice donor site probably null
R5861:C2cd3 UTSW 7 100444475 unclassified probably benign
R6110:C2cd3 UTSW 7 100441076 missense probably damaging 1.00
R6326:C2cd3 UTSW 7 100416428 missense probably benign 0.02
R6429:C2cd3 UTSW 7 100432091 missense probably damaging 1.00
R6610:C2cd3 UTSW 7 100455298 missense probably benign
R6613:C2cd3 UTSW 7 100395241 missense possibly damaging 0.87
R6631:C2cd3 UTSW 7 100418540 missense probably damaging 1.00
R6787:C2cd3 UTSW 7 100455346 missense probably benign
R6837:C2cd3 UTSW 7 100448746 missense probably damaging 1.00
R6849:C2cd3 UTSW 7 100406927 missense probably damaging 1.00
R6860:C2cd3 UTSW 7 100390241 missense probably benign 0.28
R6929:C2cd3 UTSW 7 100451619 missense probably damaging 1.00
R7026:C2cd3 UTSW 7 100432092 missense probably damaging 1.00
R7088:C2cd3 UTSW 7 100416181 missense
R7174:C2cd3 UTSW 7 100432198 missense
R7241:C2cd3 UTSW 7 100407050 missense
R7335:C2cd3 UTSW 7 100422603 missense
R7357:C2cd3 UTSW 7 100430103 missense
R7493:C2cd3 UTSW 7 100427226 missense
R7567:C2cd3 UTSW 7 100430815 missense
R7573:C2cd3 UTSW 7 100419707 missense
R7869:C2cd3 UTSW 7 100469491 missense probably damaging 0.99
R7999:C2cd3 UTSW 7 100459889 critical splice donor site probably null
R8134:C2cd3 UTSW 7 100418504 missense
R8369:C2cd3 UTSW 7 100395258 missense probably benign 0.03
R8372:C2cd3 UTSW 7 100455280 nonsense probably null
X0002:C2cd3 UTSW 7 100440235 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AACCAGGAGGAACCACTTGTG -3'
(R):5'- AGGGACCCACAGGATATTTTC -3'

Sequencing Primer
(F):5'- AACCACTTGTGCCAGGGATTC -3'
(R):5'- TTTTCCAGGCAAGCATAAAGG -3'
Posted On2016-06-06