Mutagenetix > Incidental Mutation

Incidental Mutation 'R5026:C2cd3'

391350

Institutional Source

Beutler Lab

Gene Symbol

C2cd3

Ensembl Gene

ENSMUSG00000047248

Gene Name

C2 calcium-dependent domain containing 3

Synonyms

MMRRC Submission

042617-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5026 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100372233-100470152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 100459842 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 2259 (M2259K)

Ref Sequence

ENSEMBL: ENSMUSP00000062637 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]

AlphaFold

Q52KB6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000051777
AA Change: M2259K

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: M2259K

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
low complexity region	2180	2197	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098259

SMART Domains

Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120196

SMART Domains

Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	297	308	N/A	INTRINSIC
C2	415	553	1.5e-1	SMART
C2	681	790	2.4e-2	SMART
C2	880	1020	9.5e-2	SMART
C2	1073	1212	1.1e-1	SMART
C2	1508	1615	9e-5	SMART
low complexity region	1783	1797	N/A	INTRINSIC
low complexity region	1928	1940	N/A	INTRINSIC
low complexity region	2001	2016	N/A	INTRINSIC
low complexity region	2071	2087	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183512

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184420

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184875

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193553

Meta Mutation Damage Score

0.1028

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 90.7%

Validation Efficiency

96% (88/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,317,224	N608S	probably benign	Het
Actg1	T	C	11: 120,346,958	N7S	probably damaging	Het
Adamtsl3	T	A	7: 82,576,054	L357Q	probably benign	Het
Ahnak	A	T	19: 9,010,631	Q3093L	possibly damaging	Het
Ankrd16	T	A	2: 11,789,881	V359E	probably benign	Het
Ankrd40	T	C	11: 94,339,724		probably benign	Het
Ano10	G	A	9: 122,272,559	Q49*	probably null	Het
Aoah	A	T	13: 20,914,959	D236V	probably damaging	Het
Bin1	T	C	18: 32,419,930		probably null	Het
Braf	T	C	6: 39,688,287	D49G	probably benign	Het
Brsk1	A	T	7: 4,704,266	R273W	probably damaging	Het
Cabp1	T	C	5: 115,175,472	N43D	possibly damaging	Het
Ccar2	T	A	14: 70,142,502	Q412L	possibly damaging	Het
Cd4	T	C	6: 124,866,620	T443A	possibly damaging	Het
Cdh23	T	A	10: 60,304,848	I3206F	possibly damaging	Het
Ceacam9	A	T	7: 16,725,197		probably null	Het
Chid1	T	C	7: 141,513,836	D289G	probably damaging	Het
Chmp6	T	A	11: 119,918,643	L196Q	probably damaging	Het
Cog8	A	G	8: 107,049,125	S536P	probably benign	Het
Dmxl2	A	T	9: 54,416,676	S1141R	probably damaging	Het
Dnah7a	T	G	1: 53,662,498	Y166S	probably damaging	Het
Dnah7b	G	T	1: 46,187,363	W1318L	probably damaging	Het
Ecd	A	G	14: 20,337,030	F212S	probably damaging	Het
Entpd6	A	T	2: 150,763,644	S265C	probably damaging	Het
Epb41l2	A	G	10: 25,484,308	T523A	possibly damaging	Het
Focad	T	C	4: 88,344,582	S939P	unknown	Het
Gjb3	A	T	4: 127,326,487	V84D	probably damaging	Het
Gm572	A	T	4: 148,654,844	E43V	possibly damaging	Het
Gm6185	T	A	1: 161,224,608		noncoding transcript	Het
Gria1	T	A	11: 57,310,696	C787S	probably damaging	Het
Grpel2	A	G	18: 61,715,953	L162P	probably damaging	Het
Herc1	A	G	9: 66,486,126	T4096A	probably benign	Het
Hook3	A	T	8: 26,110,757	M41K	probably damaging	Het
Ifit1bl1	T	C	19: 34,593,893	Y388C	probably damaging	Het
Ighv3-4	A	G	12: 114,253,762	Y70H	probably benign	Het
Itm2c	T	C	1: 85,906,492	L176P	probably damaging	Het
Lmtk3	G	A	7: 45,794,412		probably benign	Het
Macf1	G	A	4: 123,439,494	T2376I	possibly damaging	Het
Map1a	T	G	2: 121,307,538	S2660A	possibly damaging	Het
Mmrn2	A	G	14: 34,399,201	H676R	probably benign	Het
Nbeal1	A	T	1: 60,237,179	K693M	probably damaging	Het
Ndufa13	T	A	8: 69,895,270	R49*	probably null	Het
Neb	T	A	2: 52,204,880	T1115S	possibly damaging	Het
Nvl	C	T	1: 181,105,155	R699H	probably damaging	Het
Olfr1490	A	G	19: 13,654,932	I163V	probably benign	Het
Olfr74	A	T	2: 87,974,020	I215N	probably damaging	Het
Olfr920	A	G	9: 38,755,745	D19G	probably benign	Het
Olfr926	A	T	9: 38,877,899	H241L	possibly damaging	Het
Piezo1	G	T	8: 122,486,818	D1779E	probably benign	Het
Prl8a9	A	G	13: 27,561,577	S77P	probably damaging	Het
Prune2	A	T	19: 17,199,142	I2904F	probably damaging	Het
Retreg1	T	A	15: 25,970,128	S151T	probably damaging	Het
Rnf213	A	G	11: 119,436,764	D1859G	probably damaging	Het
Rnf39	T	C	17: 36,945,534	F173L	probably benign	Het
Rspry1	T	A	8: 94,650,303	N371K	probably damaging	Het
Samd9l	T	A	6: 3,375,284	D659V	possibly damaging	Het
Sez6	T	A	11: 77,968,989	F378Y	probably damaging	Het
Slc22a19	G	A	19: 7,674,372	T490M	probably benign	Het
Slit2	A	T	5: 48,256,805	N917I	probably damaging	Het
Smg1	T	A	7: 118,193,545		probably benign	Het
Tes	T	C	6: 17,096,340	V24A	probably benign	Het
Tial1	C	T	7: 128,448,396	E82K	probably damaging	Het
Tmem94	G	A	11: 115,793,104	C750Y	probably damaging	Het
Tmppe	T	A	9: 114,405,819	N395K	possibly damaging	Het
Tnn	T	C	1: 160,146,137	H220R	probably benign	Het
Trappc10	T	C	10: 78,204,288	T610A	possibly damaging	Het
Trmt1l	T	A	1: 151,440,876	M196K	probably damaging	Het
Trpv4	T	C	5: 114,622,654	*872W	probably null	Het
Ttn	T	C	2: 76,749,009	T23847A	probably benign	Het
Ube4b	T	A	4: 149,360,565	L440F	probably damaging	Het
Ugt1a5	C	G	1: 88,166,241	R64G	probably benign	Het
Unc13c	T	A	9: 73,930,903	T889S	possibly damaging	Het
Vmn1r215	C	T	13: 23,076,279	T163I	probably benign	Het
Vmn2r16	T	A	5: 109,360,856	Y483*	probably null	Het
Wdr47	T	A	3: 108,618,522	C120*	probably null	Het
Zc3h6	G	A	2: 129,017,309	V1087I	probably benign	Het
Zfp423	T	C	8: 87,780,674	H889R	probably damaging	Het
Zfp825	G	T	13: 74,481,077	H107N	probably benign	Het
Zfp945	T	C	17: 22,850,885	H680R	probably damaging	Het

Other mutations in C2cd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:C2cd3	APN	7	100391128	missense	probably benign	0.14
IGL01420:C2cd3	APN	7	100454858	missense	probably benign	0.35
IGL01775:C2cd3	APN	7	100443431	missense	probably damaging	1.00
IGL01832:C2cd3	APN	7	100427214	missense	possibly damaging	0.94
IGL01883:C2cd3	APN	7	100374486	missense	possibly damaging	0.80
IGL02664:C2cd3	APN	7	100419715	missense	possibly damaging	0.67
IGL02697:C2cd3	APN	7	100427169	unclassified	probably benign
IGL02852:C2cd3	APN	7	100430189	missense	probably damaging	1.00
IGL03158:C2cd3	APN	7	100374476	missense	probably damaging	1.00
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0124:C2cd3	UTSW	7	100469518	missense	probably benign
R0387:C2cd3	UTSW	7	100422507	splice site	probably benign
R0522:C2cd3	UTSW	7	100395222	missense	probably benign	0.14
R1124:C2cd3	UTSW	7	100422681	missense	probably benign	0.00
R1484:C2cd3	UTSW	7	100440190	missense	probably damaging	1.00
R1533:C2cd3	UTSW	7	100406077	missense	possibly damaging	0.54
R1631:C2cd3	UTSW	7	100372497	critical splice donor site	probably null
R1875:C2cd3	UTSW	7	100407025	missense	possibly damaging	0.89
R2059:C2cd3	UTSW	7	100455493	unclassified	probably benign
R2060:C2cd3	UTSW	7	100454948	missense	probably damaging	1.00
R2348:C2cd3	UTSW	7	100413366	missense	probably damaging	1.00
R3103:C2cd3	UTSW	7	100395252	missense	possibly damaging	0.47
R3405:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R3687:C2cd3	UTSW	7	100435833	missense	probably benign	0.28
R3775:C2cd3	UTSW	7	100431998	missense	probably damaging	1.00
R3854:C2cd3	UTSW	7	100454601	critical splice acceptor site	probably null
R4359:C2cd3	UTSW	7	100441089	missense	probably damaging	1.00
R4403:C2cd3	UTSW	7	100432099	missense	probably damaging	1.00
R4446:C2cd3	UTSW	7	100374477	missense	probably damaging	1.00
R4646:C2cd3	UTSW	7	100372450	unclassified	probably benign
R4705:C2cd3	UTSW	7	100395188	missense	possibly damaging	0.77
R4770:C2cd3	UTSW	7	100443435	missense	probably damaging	1.00
R4777:C2cd3	UTSW	7	100416332	missense	possibly damaging	0.46
R4816:C2cd3	UTSW	7	100391019	missense	probably benign	0.01
R4842:C2cd3	UTSW	7	100416190	missense	probably benign	0.00
R4858:C2cd3	UTSW	7	100454953	missense	probably damaging	1.00
R4871:C2cd3	UTSW	7	100413374	missense	possibly damaging	0.79
R4898:C2cd3	UTSW	7	100405959	missense	probably damaging	1.00
R5112:C2cd3	UTSW	7	100443485	missense	possibly damaging	0.91
R5242:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R5538:C2cd3	UTSW	7	100455493	critical splice donor site	probably null
R5861:C2cd3	UTSW	7	100444475	unclassified	probably benign
R6110:C2cd3	UTSW	7	100441076	missense	probably damaging	1.00
R6326:C2cd3	UTSW	7	100416428	missense	probably benign	0.02
R6429:C2cd3	UTSW	7	100432091	missense	probably damaging	1.00
R6610:C2cd3	UTSW	7	100455298	missense	probably benign
R6613:C2cd3	UTSW	7	100395241	missense	possibly damaging	0.87
R6631:C2cd3	UTSW	7	100418540	missense	probably damaging	1.00
R6787:C2cd3	UTSW	7	100455346	missense	probably benign
R6837:C2cd3	UTSW	7	100448746	missense	probably damaging	1.00
R6849:C2cd3	UTSW	7	100406927	missense	probably damaging	1.00
R6860:C2cd3	UTSW	7	100390241	missense	probably benign	0.28
R6929:C2cd3	UTSW	7	100451619	missense	probably damaging	1.00
R7026:C2cd3	UTSW	7	100432092	missense	probably damaging	1.00
R7088:C2cd3	UTSW	7	100416181	missense
R7174:C2cd3	UTSW	7	100432198	missense
R7241:C2cd3	UTSW	7	100407050	missense
R7335:C2cd3	UTSW	7	100422603	missense
R7357:C2cd3	UTSW	7	100430103	missense
R7493:C2cd3	UTSW	7	100427226	missense
R7567:C2cd3	UTSW	7	100430815	missense
R7573:C2cd3	UTSW	7	100419707	missense
R7869:C2cd3	UTSW	7	100469491	missense	probably damaging	0.99
R7999:C2cd3	UTSW	7	100459889	critical splice donor site	probably null
R8134:C2cd3	UTSW	7	100418504	missense
R8369:C2cd3	UTSW	7	100395258	missense	probably benign	0.03
R8372:C2cd3	UTSW	7	100455280	nonsense	probably null
R8753:C2cd3	UTSW	7	100399817	critical splice donor site	probably null
R8893:C2cd3	UTSW	7	100454797	missense	probably benign
R8905:C2cd3	UTSW	7	100424925	critical splice donor site	probably null
R8945:C2cd3	UTSW	7	100391079	missense	possibly damaging	0.88
R8970:C2cd3	UTSW	7	100419764	missense
R9000:C2cd3	UTSW	7	100416074	missense
R9064:C2cd3	UTSW	7	100410401	missense
R9072:C2cd3	UTSW	7	100391084	missense	probably benign	0.07
R9126:C2cd3	UTSW	7	100432223	missense
R9160:C2cd3	UTSW	7	100426029	missense
R9234:C2cd3	UTSW	7	100399805	missense
R9258:C2cd3	UTSW	7	100448819	missense
R9295:C2cd3	UTSW	7	100432527	missense
R9411:C2cd3	UTSW	7	100416497	missense
R9420:C2cd3	UTSW	7	100416055	missense
R9589:C2cd3	UTSW	7	100432549	missense
R9628:C2cd3	UTSW	7	100448754	missense
R9629:C2cd3	UTSW	7	100380042	missense	probably damaging	1.00
R9681:C2cd3	UTSW	7	100374455	missense	probably benign	0.32
R9775:C2cd3	UTSW	7	100427251	missense
X0002:C2cd3	UTSW	7	100440235	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- AACCAGGAGGAACCACTTGTG -3'
(R):5'- AGGGACCCACAGGATATTTTC -3'

Sequencing Primer
(F):5'- AACCACTTGTGCCAGGGATTC -3'
(R):5'- TTTTCCAGGCAAGCATAAAGG -3'

Posted On

2016-06-06