Incidental Mutation 'R5026:Sez6'
ID391371
Institutional Source Beutler Lab
Gene Symbol Sez6
Ensembl Gene ENSMUSG00000000632
Gene Nameseizure related gene 6
SynonymsD11Bhm177e, sez-6
MMRRC Submission 042617-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5026 (G1)
Quality Score186
Status Validated
Chromosome11
Chromosomal Location77930800-77979048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77968989 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 378 (F378Y)
Ref Sequence ENSEMBL: ENSMUSP00000091532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000646] [ENSMUST00000093995]
Predicted Effect probably damaging
Transcript: ENSMUST00000000646
AA Change: F378Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000646
Gene: ENSMUSG00000000632
AA Change: F378Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 910 932 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093995
AA Change: F378Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091532
Gene: ENSMUSG00000000632
AA Change: F378Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138749
Predicted Effect probably benign
Transcript: ENSMUST00000140630
SMART Domains Protein: ENSMUSP00000115660
Gene: ENSMUSG00000000632

DomainStartEndE-ValueType
CUB 29 140 9.8e-28 SMART
CCP 157 214 5.43e-12 SMART
Pfam:CUB 218 278 1.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142542
Predicted Effect unknown
Transcript: ENSMUST00000151982
AA Change: F211Y
SMART Domains Protein: ENSMUSP00000132041
Gene: ENSMUSG00000000632
AA Change: F211Y

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
CUB 75 184 9.36e-2 SMART
CCP 188 243 1.23e-10 SMART
CUB 247 358 8.08e-29 SMART
low complexity region 379 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155087
Meta Mutation Damage Score 0.7292 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 90.7%
Validation Efficiency 96% (88/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain five cysteine-rich motifs that are similar to sushi domains, as well as two domains similar to the amino terminal half of the CUB (for complement C1r/C1s, Uegf, Bmp1) domain. Mutations in this gene have been associated with febrile seizures. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased short dendrites, decreased excitatory synaptic signaling, resistance to pharmacologically induces seizures, decreased activity and impaired learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,317,224 N608S probably benign Het
Actg1 T C 11: 120,346,958 N7S probably damaging Het
Adamtsl3 T A 7: 82,576,054 L357Q probably benign Het
Ahnak A T 19: 9,010,631 Q3093L possibly damaging Het
Ankrd16 T A 2: 11,789,881 V359E probably benign Het
Ankrd40 T C 11: 94,339,724 probably benign Het
Ano10 G A 9: 122,272,559 Q49* probably null Het
Aoah A T 13: 20,914,959 D236V probably damaging Het
Bin1 T C 18: 32,419,930 probably null Het
Braf T C 6: 39,688,287 D49G probably benign Het
Brsk1 A T 7: 4,704,266 R273W probably damaging Het
C2cd3 T A 7: 100,459,842 M2259K possibly damaging Het
Cabp1 T C 5: 115,175,472 N43D possibly damaging Het
Ccar2 T A 14: 70,142,502 Q412L possibly damaging Het
Cd4 T C 6: 124,866,620 T443A possibly damaging Het
Cdh23 T A 10: 60,304,848 I3206F possibly damaging Het
Ceacam9 A T 7: 16,725,197 probably null Het
Chid1 T C 7: 141,513,836 D289G probably damaging Het
Chmp6 T A 11: 119,918,643 L196Q probably damaging Het
Cog8 A G 8: 107,049,125 S536P probably benign Het
Dmxl2 A T 9: 54,416,676 S1141R probably damaging Het
Dnah7a T G 1: 53,662,498 Y166S probably damaging Het
Dnah7b G T 1: 46,187,363 W1318L probably damaging Het
Ecd A G 14: 20,337,030 F212S probably damaging Het
Entpd6 A T 2: 150,763,644 S265C probably damaging Het
Epb41l2 A G 10: 25,484,308 T523A possibly damaging Het
Focad T C 4: 88,344,582 S939P unknown Het
Gjb3 A T 4: 127,326,487 V84D probably damaging Het
Gm572 A T 4: 148,654,844 E43V possibly damaging Het
Gm6185 T A 1: 161,224,608 noncoding transcript Het
Gria1 T A 11: 57,310,696 C787S probably damaging Het
Grpel2 A G 18: 61,715,953 L162P probably damaging Het
Herc1 A G 9: 66,486,126 T4096A probably benign Het
Hook3 A T 8: 26,110,757 M41K probably damaging Het
Ifit1bl1 T C 19: 34,593,893 Y388C probably damaging Het
Ighv3-4 A G 12: 114,253,762 Y70H probably benign Het
Itm2c T C 1: 85,906,492 L176P probably damaging Het
Lmtk3 G A 7: 45,794,412 probably benign Het
Macf1 G A 4: 123,439,494 T2376I possibly damaging Het
Map1a T G 2: 121,307,538 S2660A possibly damaging Het
Mmrn2 A G 14: 34,399,201 H676R probably benign Het
Nbeal1 A T 1: 60,237,179 K693M probably damaging Het
Ndufa13 T A 8: 69,895,270 R49* probably null Het
Neb T A 2: 52,204,880 T1115S possibly damaging Het
Nvl C T 1: 181,105,155 R699H probably damaging Het
Olfr1490 A G 19: 13,654,932 I163V probably benign Het
Olfr74 A T 2: 87,974,020 I215N probably damaging Het
Olfr920 A G 9: 38,755,745 D19G probably benign Het
Olfr926 A T 9: 38,877,899 H241L possibly damaging Het
Piezo1 G T 8: 122,486,818 D1779E probably benign Het
Prl8a9 A G 13: 27,561,577 S77P probably damaging Het
Prune2 A T 19: 17,199,142 I2904F probably damaging Het
Retreg1 T A 15: 25,970,128 S151T probably damaging Het
Rnf213 A G 11: 119,436,764 D1859G probably damaging Het
Rnf39 T C 17: 36,945,534 F173L probably benign Het
Rspry1 T A 8: 94,650,303 N371K probably damaging Het
Samd9l T A 6: 3,375,284 D659V possibly damaging Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Slit2 A T 5: 48,256,805 N917I probably damaging Het
Smg1 T A 7: 118,193,545 probably benign Het
Tes T C 6: 17,096,340 V24A probably benign Het
Tial1 C T 7: 128,448,396 E82K probably damaging Het
Tmem94 G A 11: 115,793,104 C750Y probably damaging Het
Tmppe T A 9: 114,405,819 N395K possibly damaging Het
Tnn T C 1: 160,146,137 H220R probably benign Het
Trappc10 T C 10: 78,204,288 T610A possibly damaging Het
Trmt1l T A 1: 151,440,876 M196K probably damaging Het
Trpv4 T C 5: 114,622,654 *872W probably null Het
Ttn T C 2: 76,749,009 T23847A probably benign Het
Ube4b T A 4: 149,360,565 L440F probably damaging Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Unc13c T A 9: 73,930,903 T889S possibly damaging Het
Vmn1r215 C T 13: 23,076,279 T163I probably benign Het
Vmn2r16 T A 5: 109,360,856 Y483* probably null Het
Wdr47 T A 3: 108,618,522 C120* probably null Het
Zc3h6 G A 2: 129,017,309 V1087I probably benign Het
Zfp423 T C 8: 87,780,674 H889R probably damaging Het
Zfp825 G T 13: 74,481,077 H107N probably benign Het
Zfp945 T C 17: 22,850,885 H680R probably damaging Het
Other mutations in Sez6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Sez6 APN 11 77977289 splice site probably benign
IGL01142:Sez6 APN 11 77973816 missense probably damaging 1.00
IGL02252:Sez6 APN 11 77974513 missense probably damaging 1.00
IGL02332:Sez6 APN 11 77954742 splice site probably benign
IGL02366:Sez6 APN 11 77976882 missense probably damaging 0.98
IGL02479:Sez6 APN 11 77978026 missense possibly damaging 0.84
IGL02963:Sez6 APN 11 77962949 missense possibly damaging 0.93
R0054:Sez6 UTSW 11 77953873 missense possibly damaging 0.94
R0054:Sez6 UTSW 11 77953873 missense possibly damaging 0.94
R0089:Sez6 UTSW 11 77974344 splice site probably benign
R0485:Sez6 UTSW 11 77953813 missense probably damaging 1.00
R0598:Sez6 UTSW 11 77977821 missense possibly damaging 0.88
R0729:Sez6 UTSW 11 77976585 missense probably benign 0.01
R1117:Sez6 UTSW 11 77974514 missense probably damaging 1.00
R1199:Sez6 UTSW 11 77953885 missense probably benign
R1534:Sez6 UTSW 11 77963045 missense probably damaging 1.00
R1835:Sez6 UTSW 11 77953503 missense probably benign
R1840:Sez6 UTSW 11 77953717 missense possibly damaging 0.79
R1929:Sez6 UTSW 11 77972932 missense probably damaging 1.00
R1970:Sez6 UTSW 11 77954068 critical splice donor site probably null
R3156:Sez6 UTSW 11 77953779 missense possibly damaging 0.63
R3930:Sez6 UTSW 11 77976882 missense probably damaging 0.98
R3931:Sez6 UTSW 11 77976882 missense probably damaging 0.98
R4894:Sez6 UTSW 11 77975260 missense probably damaging 1.00
R4904:Sez6 UTSW 11 77975254 missense probably damaging 1.00
R5040:Sez6 UTSW 11 77969089 critical splice donor site probably null
R5057:Sez6 UTSW 11 77973153 missense probably damaging 1.00
R5093:Sez6 UTSW 11 77976562 missense possibly damaging 0.88
R5640:Sez6 UTSW 11 77973759 intron probably benign
R6013:Sez6 UTSW 11 77973797 missense probably damaging 1.00
R6126:Sez6 UTSW 11 77973804 missense probably damaging 1.00
R6153:Sez6 UTSW 11 77977822 missense probably damaging 0.99
R6279:Sez6 UTSW 11 77976541 missense possibly damaging 0.63
R6300:Sez6 UTSW 11 77976541 missense possibly damaging 0.63
R6475:Sez6 UTSW 11 77973844
R6722:Sez6 UTSW 11 77953702 missense probably damaging 1.00
R6897:Sez6 UTSW 11 77953559 missense probably damaging 1.00
R6910:Sez6 UTSW 11 77953869 missense possibly damaging 0.85
R7012:Sez6 UTSW 11 77977795 missense probably benign 0.04
R7233:Sez6 UTSW 11 77973137 missense probably damaging 1.00
R7265:Sez6 UTSW 11 77962865 missense probably damaging 0.96
R7289:Sez6 UTSW 11 77974323 missense possibly damaging 0.96
R7405:Sez6 UTSW 11 77962891 missense probably benign 0.10
R7408:Sez6 UTSW 11 77953530 missense probably damaging 1.00
R7485:Sez6 UTSW 11 77973885 missense probably benign 0.01
R7592:Sez6 UTSW 11 77978050 missense probably damaging 0.99
R7778:Sez6 UTSW 11 77974549 missense probably damaging 1.00
R7793:Sez6 UTSW 11 77977600 missense probably damaging 1.00
R7818:Sez6 UTSW 11 77976902 missense probably damaging 1.00
R7824:Sez6 UTSW 11 77974549 missense probably damaging 1.00
R8008:Sez6 UTSW 11 77973256 nonsense probably null
X0013:Sez6 UTSW 11 77954780 missense probably benign 0.01
X0067:Sez6 UTSW 11 77974438 critical splice acceptor site probably null
Z1088:Sez6 UTSW 11 77973197 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGGACTTCCAATGCATCTTCTG -3'
(R):5'- TGGAGATCAGAGAATGACCCC -3'

Sequencing Primer
(F):5'- TGCATCTTCTGAGCCCAAAGG -3'
(R):5'- GAGATCAGAGAATGACCCCCTCAC -3'
Posted On2016-06-06