Incidental Mutation 'R5027:Apoe'
ID391421
Institutional Source Beutler Lab
Gene Symbol Apoe
Ensembl Gene ENSMUSG00000002985
Gene Nameapolipoprotein E
Synonyms
MMRRC Submission 042618-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R5027 (G1)
Quality Score198
Status Validated
Chromosome7
Chromosomal Location19696109-19699188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19697015 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 101 (A101T)
Ref Sequence ENSEMBL: ENSMUSP00000134160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003066] [ENSMUST00000032555] [ENSMUST00000045035] [ENSMUST00000093552] [ENSMUST00000108451] [ENSMUST00000172808] [ENSMUST00000172983] [ENSMUST00000173739] [ENSMUST00000174064] [ENSMUST00000174144] [ENSMUST00000174191] [ENSMUST00000174355] [ENSMUST00000174710] [ENSMUST00000207978]
Predicted Effect probably damaging
Transcript: ENSMUST00000003066
AA Change: A101T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003066
Gene: ENSMUSG00000002985
AA Change: A101T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032555
SMART Domains Protein: ENSMUSP00000032555
Gene: ENSMUSG00000002984

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 7.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045035
SMART Domains Protein: ENSMUSP00000045571
Gene: ENSMUSG00000040564

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ApoC-I 27 87 1.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093552
SMART Domains Protein: ENSMUSP00000104090
Gene: ENSMUSG00000002984

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 1.5e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108451
SMART Domains Protein: ENSMUSP00000104091
Gene: ENSMUSG00000040564

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ApoC-I 27 87 3.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167646
SMART Domains Protein: ENSMUSP00000132032
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 201 1.9e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172808
AA Change: A90T

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134558
Gene: ENSMUSG00000002985
AA Change: A90T

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Apolipoprotein 61 146 8.5e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172983
AA Change: A101T

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133359
Gene: ENSMUSG00000002985
AA Change: A101T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 232 1.3e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173739
AA Change: A101T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133371
Gene: ENSMUSG00000002985
AA Change: A101T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174064
AA Change: A101T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133302
Gene: ENSMUSG00000002985
AA Change: A101T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 73 284 2e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174144
AA Change: A101T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134622
Gene: ENSMUSG00000002985
AA Change: A101T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 232 1.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174191
SMART Domains Protein: ENSMUSP00000133447
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:1YA9|A 20 70 8e-31 PDB
SCOP:d1nfn__ 34 70 5e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174355
AA Change: A101T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134160
Gene: ENSMUSG00000002985
AA Change: A101T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174476
Predicted Effect probably benign
Transcript: ENSMUST00000174710
SMART Domains Protein: ENSMUSP00000134429
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:1YA9|A 20 70 8e-31 PDB
SCOP:d1nfn__ 34 70 5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207525
Predicted Effect probably benign
Transcript: ENSMUST00000207978
Meta Mutation Damage Score 0.7835 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: This gene encodes a member of the apolipoprotein A1/A4/E family of proteins. This protein is involved in the transport of lipoproteins in the blood. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. Homozygous knockout mice for this gene accumulate high levels of cholesterol in the blood and develop atherosclerosis. Different alleles of this gene have been associated with either increased risk or a protective effect for Alzheimer's disease in human patients. This gene maps to chromosome 7 in a cluster with the related apolipoprotein C1, C2 and C4 genes. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mutations at this locus cause diet-induced hypercholesterolemia and atherosclerosis. Homozygous null mutants also develop foam-cell rich deposits in proximal aorta, impaired blood-nerve and blood-brain barriers, and many xanthomatous lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
Abca14 T G 7: 120,312,282 I1363R probably benign Het
Abcc1 T C 16: 14,404,053 probably null Het
Adgrf1 T A 17: 43,303,747 F241I probably damaging Het
Afg3l1 T C 8: 123,489,814 M264T probably benign Het
Ankle1 T C 8: 71,408,979 S434P probably damaging Het
Apol11a G T 15: 77,516,953 K213N probably damaging Het
Asap2 A G 12: 21,204,081 M198V probably damaging Het
Atg4b C T 1: 93,786,575 A360V probably benign Het
B3gnt5 T A 16: 19,769,694 V221D probably damaging Het
Baz2b A T 2: 60,098,644 probably benign Het
Cep350 C A 1: 155,933,354 W492L probably benign Het
Cln6 A G 9: 62,847,093 Y139C probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cul9 C T 17: 46,500,782 E2507K probably damaging Het
Ddx58 T A 4: 40,208,845 M756L probably benign Het
Dgkz A T 2: 91,945,543 V125D probably benign Het
Dnah17 T C 11: 118,102,539 M1127V probably benign Het
Dnajb1 C A 8: 83,610,103 D67E probably benign Het
Dync1li1 A G 9: 114,713,544 D258G probably damaging Het
Egflam G T 15: 7,253,644 P311T probably benign Het
Fbxw11 T A 11: 32,652,811 probably benign Het
Fn3krp T G 11: 121,429,448 D206E probably benign Het
Fsip2 A G 2: 82,989,133 H5070R possibly damaging Het
Gm6169 A G 13: 97,099,140 I33T probably benign Het
Gm6605 T C 7: 38,450,259 noncoding transcript Het
Gna14 C A 19: 16,603,272 T158K probably benign Het
Gstt2 A T 10: 75,831,892 I243N probably damaging Het
Haus6 C T 4: 86,605,696 D50N possibly damaging Het
Hcrtr2 A G 9: 76,323,296 I70T probably benign Het
Herc1 G A 9: 66,473,529 V3563I probably benign Het
Herc1 A T 9: 66,504,618 I4707F probably damaging Het
Hic2 C T 16: 17,258,747 A480V possibly damaging Het
Hsd17b3 A G 13: 64,062,906 Y212H probably damaging Het
Hspa5 A G 2: 34,775,815 K557R probably damaging Het
Iqch T C 9: 63,525,012 E367G possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lars2 A G 9: 123,441,495 M551V probably benign Het
Lbp T C 2: 158,308,726 I57T possibly damaging Het
Litaf T C 16: 10,961,004 Q142R possibly damaging Het
Lpar5 G C 6: 125,082,147 R277P possibly damaging Het
Muc6 T A 7: 141,636,436 I2710F probably benign Het
Myo7b T A 18: 31,975,212 I1199F probably benign Het
Naca A C 10: 128,048,121 E2140D possibly damaging Het
Nup214 G T 2: 31,991,317 G396C probably damaging Het
Olfr1052 G A 2: 86,298,196 V127I possibly damaging Het
Olfr259 T A 2: 87,107,806 I194F probably benign Het
Olfr56 A T 11: 49,134,624 Q144L probably benign Het
Olfr853 A G 9: 19,537,277 Y218H probably damaging Het
Olfr983 A T 9: 40,092,394 S187T probably damaging Het
P4htm A G 9: 108,579,293 V436A probably benign Het
Pfkm A G 15: 98,119,426 I117V possibly damaging Het
Phlpp1 T G 1: 106,281,471 V518G probably damaging Het
Piwil4 G A 9: 14,709,944 L598F probably damaging Het
Polr1b T G 2: 129,123,883 I815R possibly damaging Het
Ppef2 T C 5: 92,234,291 N515S probably damaging Het
Prpsap2 G T 11: 61,741,004 probably null Het
Rab27a A G 9: 73,095,413 D208G probably benign Het
Ralgds A G 2: 28,552,090 probably null Het
Raph1 C A 1: 60,496,277 C540F probably damaging Het
Rbsn A G 6: 92,198,250 L281P probably damaging Het
Rmdn1 G T 4: 19,588,533 G110* probably null Het
Rph3a T A 5: 120,954,449 E363V possibly damaging Het
Serpina16 G T 12: 103,675,003 Y154* probably null Het
Sh2d3c G A 2: 32,744,802 E198K possibly damaging Het
Shank2 C A 7: 144,259,105 Y663* probably null Het
Sharpin T C 15: 76,350,025 probably benign Het
Slitrk1 G A 14: 108,912,308 P324S probably benign Het
Sorbs2 T A 8: 45,746,534 probably null Het
Spag16 C T 1: 69,923,804 probably benign Het
Sycp2l A T 13: 41,129,771 probably null Het
Synj1 A T 16: 90,940,519 probably null Het
Sytl1 T C 4: 133,256,219 probably benign Het
Tkfc A T 19: 10,592,659 probably null Het
Tnn T C 1: 160,145,211 T274A probably damaging Het
Trav14-2 T A 14: 53,641,048 W35R probably damaging Het
Trim72 T C 7: 128,007,965 M222T probably damaging Het
Trim9 A G 12: 70,346,708 V154A probably damaging Het
Ttc7b T C 12: 100,301,742 Y266C probably damaging Het
Uchl3 T A 14: 101,666,546 I43K possibly damaging Het
Vdac1 T A 11: 52,388,478 N269K possibly damaging Het
Wdr72 T A 9: 74,145,976 W187R probably damaging Het
Zfp30 T A 7: 29,793,066 C248* probably null Het
Zfp940 A T 7: 29,850,956 probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Apoe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Apoe APN 7 19696600 missense probably damaging 1.00
IGL03324:Apoe APN 7 19696537 missense probably benign 0.05
R0008:Apoe UTSW 7 19697080 missense probably damaging 0.99
R2860:Apoe UTSW 7 19697554 missense probably damaging 1.00
R2861:Apoe UTSW 7 19697554 missense probably damaging 1.00
R2862:Apoe UTSW 7 19697554 missense probably damaging 1.00
R3919:Apoe UTSW 7 19696547 missense probably benign 0.00
R4583:Apoe UTSW 7 19697498 missense possibly damaging 0.66
R4756:Apoe UTSW 7 19696921 missense probably benign 0.20
R6188:Apoe UTSW 7 19698380 intron probably benign
R6464:Apoe UTSW 7 19697536 missense probably damaging 1.00
R7652:Apoe UTSW 7 19696610 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGCCTTGTACACAGCTAGG -3'
(R):5'- TGAGTGTCCAGCTCTTTCAC -3'

Sequencing Primer
(F):5'- TAGGCGCTTCTGCAGATCC -3'
(R):5'- CTGTAACTCAAGCTGGCTTCGAAG -3'
Posted On2016-06-06