Incidental Mutation 'R5027:Asap2'
ID391459
Institutional Source Beutler Lab
Gene Symbol Asap2
Ensembl Gene ENSMUSG00000052632
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms6530401G17Rik, LOC385250, Ddef2
MMRRC Submission 042618-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R5027 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location20990459-21270171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21204081 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 198 (M198V)
Ref Sequence ENSEMBL: ENSMUSP00000054631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050990] [ENSMUST00000064595] [ENSMUST00000090834] [ENSMUST00000101562]
Predicted Effect probably damaging
Transcript: ENSMUST00000050990
AA Change: M198V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054631
Gene: ENSMUSG00000052632
AA Change: M198V

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
SH3 896 954 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064595
AA Change: M198V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063217
Gene: ENSMUSG00000052632
AA Change: M198V

DomainStartEndE-ValueType
Pfam:BAR 11 247 2.4e-9 PFAM
Pfam:BAR_3 31 265 3.3e-28 PFAM
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 892 N/A INTRINSIC
SH3 941 999 4.28e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000090834
AA Change: M198V

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088344
Gene: ENSMUSG00000052632
AA Change: M198V

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
Blast:PH 196 318 1e-50 BLAST
Blast:ArfGap 334 395 5e-30 BLAST
ANK 438 470 6.17e-1 SMART
ANK 474 503 4.03e-5 SMART
ANK 507 537 1.48e3 SMART
low complexity region 547 561 N/A INTRINSIC
low complexity region 619 643 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
SH3 750 808 4.28e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101562
AA Change: M198V

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099098
Gene: ENSMUSG00000052632
AA Change: M198V

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 309 402 2.31e-18 SMART
ArfGap 424 544 6.82e-27 SMART
ANK 587 619 6.17e-1 SMART
ANK 623 652 4.03e-5 SMART
ANK 656 686 1.48e3 SMART
low complexity region 696 710 N/A INTRINSIC
low complexity region 768 792 N/A INTRINSIC
low complexity region 830 850 N/A INTRINSIC
SH3 899 957 4.28e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174530
Meta Mutation Damage Score 0.1769 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
Abca14 T G 7: 120,312,282 I1363R probably benign Het
Abcc1 T C 16: 14,404,053 probably null Het
Adgrf1 T A 17: 43,303,747 F241I probably damaging Het
Afg3l1 T C 8: 123,489,814 M264T probably benign Het
Ankle1 T C 8: 71,408,979 S434P probably damaging Het
Apoe C T 7: 19,697,015 A101T probably damaging Het
Apol11a G T 15: 77,516,953 K213N probably damaging Het
Atg4b C T 1: 93,786,575 A360V probably benign Het
B3gnt5 T A 16: 19,769,694 V221D probably damaging Het
Baz2b A T 2: 60,098,644 probably benign Het
Cep350 C A 1: 155,933,354 W492L probably benign Het
Cln6 A G 9: 62,847,093 Y139C probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cul9 C T 17: 46,500,782 E2507K probably damaging Het
Ddx58 T A 4: 40,208,845 M756L probably benign Het
Dgkz A T 2: 91,945,543 V125D probably benign Het
Dnah17 T C 11: 118,102,539 M1127V probably benign Het
Dnajb1 C A 8: 83,610,103 D67E probably benign Het
Dync1li1 A G 9: 114,713,544 D258G probably damaging Het
Egflam G T 15: 7,253,644 P311T probably benign Het
Fbxw11 T A 11: 32,652,811 probably benign Het
Fn3krp T G 11: 121,429,448 D206E probably benign Het
Fsip2 A G 2: 82,989,133 H5070R possibly damaging Het
Gm6169 A G 13: 97,099,140 I33T probably benign Het
Gm6605 T C 7: 38,450,259 noncoding transcript Het
Gna14 C A 19: 16,603,272 T158K probably benign Het
Gstt2 A T 10: 75,831,892 I243N probably damaging Het
Haus6 C T 4: 86,605,696 D50N possibly damaging Het
Hcrtr2 A G 9: 76,323,296 I70T probably benign Het
Herc1 G A 9: 66,473,529 V3563I probably benign Het
Herc1 A T 9: 66,504,618 I4707F probably damaging Het
Hic2 C T 16: 17,258,747 A480V possibly damaging Het
Hsd17b3 A G 13: 64,062,906 Y212H probably damaging Het
Hspa5 A G 2: 34,775,815 K557R probably damaging Het
Iqch T C 9: 63,525,012 E367G possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lars2 A G 9: 123,441,495 M551V probably benign Het
Lbp T C 2: 158,308,726 I57T possibly damaging Het
Litaf T C 16: 10,961,004 Q142R possibly damaging Het
Lpar5 G C 6: 125,082,147 R277P possibly damaging Het
Muc6 T A 7: 141,636,436 I2710F probably benign Het
Myo7b T A 18: 31,975,212 I1199F probably benign Het
Naca A C 10: 128,048,121 E2140D possibly damaging Het
Nup214 G T 2: 31,991,317 G396C probably damaging Het
Olfr1052 G A 2: 86,298,196 V127I possibly damaging Het
Olfr259 T A 2: 87,107,806 I194F probably benign Het
Olfr56 A T 11: 49,134,624 Q144L probably benign Het
Olfr853 A G 9: 19,537,277 Y218H probably damaging Het
Olfr983 A T 9: 40,092,394 S187T probably damaging Het
P4htm A G 9: 108,579,293 V436A probably benign Het
Pfkm A G 15: 98,119,426 I117V possibly damaging Het
Phlpp1 T G 1: 106,281,471 V518G probably damaging Het
Piwil4 G A 9: 14,709,944 L598F probably damaging Het
Polr1b T G 2: 129,123,883 I815R possibly damaging Het
Ppef2 T C 5: 92,234,291 N515S probably damaging Het
Prpsap2 G T 11: 61,741,004 probably null Het
Rab27a A G 9: 73,095,413 D208G probably benign Het
Ralgds A G 2: 28,552,090 probably null Het
Raph1 C A 1: 60,496,277 C540F probably damaging Het
Rbsn A G 6: 92,198,250 L281P probably damaging Het
Rmdn1 G T 4: 19,588,533 G110* probably null Het
Rph3a T A 5: 120,954,449 E363V possibly damaging Het
Serpina16 G T 12: 103,675,003 Y154* probably null Het
Sh2d3c G A 2: 32,744,802 E198K possibly damaging Het
Shank2 C A 7: 144,259,105 Y663* probably null Het
Sharpin T C 15: 76,350,025 probably benign Het
Slitrk1 G A 14: 108,912,308 P324S probably benign Het
Sorbs2 T A 8: 45,746,534 probably null Het
Spag16 C T 1: 69,923,804 probably benign Het
Sycp2l A T 13: 41,129,771 probably null Het
Synj1 A T 16: 90,940,519 probably null Het
Sytl1 T C 4: 133,256,219 probably benign Het
Tkfc A T 19: 10,592,659 probably null Het
Tnn T C 1: 160,145,211 T274A probably damaging Het
Trav14-2 T A 14: 53,641,048 W35R probably damaging Het
Trim72 T C 7: 128,007,965 M222T probably damaging Het
Trim9 A G 12: 70,346,708 V154A probably damaging Het
Ttc7b T C 12: 100,301,742 Y266C probably damaging Het
Uchl3 T A 14: 101,666,546 I43K possibly damaging Het
Vdac1 T A 11: 52,388,478 N269K possibly damaging Het
Wdr72 T A 9: 74,145,976 W187R probably damaging Het
Zfp30 T A 7: 29,793,066 C248* probably null Het
Zfp940 A T 7: 29,850,956 probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Asap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Asap2 APN 12 21239648 missense possibly damaging 0.66
IGL01140:Asap2 APN 12 21206316 missense probably damaging 1.00
IGL01285:Asap2 APN 12 21229263 missense probably damaging 1.00
IGL01318:Asap2 APN 12 21247295 missense probably null 0.00
IGL01355:Asap2 APN 12 21218086 splice site probably benign
IGL01593:Asap2 APN 12 21213202 missense probably null 0.03
IGL01705:Asap2 APN 12 21249368 missense possibly damaging 0.85
IGL01716:Asap2 APN 12 21254306 missense possibly damaging 0.94
IGL02822:Asap2 APN 12 21265910 missense probably damaging 1.00
IGL02876:Asap2 APN 12 21258163 missense probably benign 0.00
IGL02991:Asap2 APN 12 21249293 splice site probably benign
R0157:Asap2 UTSW 12 21206325 missense probably damaging 1.00
R0399:Asap2 UTSW 12 21217997 missense possibly damaging 0.90
R0472:Asap2 UTSW 12 21213185 missense possibly damaging 0.47
R0959:Asap2 UTSW 12 21247319 missense probably damaging 1.00
R0981:Asap2 UTSW 12 21265960 missense probably damaging 0.98
R1141:Asap2 UTSW 12 21185110 missense probably damaging 1.00
R1382:Asap2 UTSW 12 21265954 missense probably damaging 1.00
R1418:Asap2 UTSW 12 21239585 missense probably damaging 1.00
R1418:Asap2 UTSW 12 21239589 missense probably damaging 1.00
R1469:Asap2 UTSW 12 21213179 missense probably benign 0.00
R1469:Asap2 UTSW 12 21213179 missense probably benign 0.00
R1526:Asap2 UTSW 12 21185187 missense probably damaging 1.00
R1542:Asap2 UTSW 12 21265997 missense probably damaging 1.00
R1710:Asap2 UTSW 12 21224392 missense probably damaging 1.00
R1750:Asap2 UTSW 12 21203998 missense probably damaging 1.00
R2151:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2152:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2154:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2323:Asap2 UTSW 12 21203968 missense probably damaging 1.00
R2378:Asap2 UTSW 12 21254318 missense possibly damaging 0.95
R3151:Asap2 UTSW 12 21224377 missense probably damaging 1.00
R3757:Asap2 UTSW 12 21267766 missense probably damaging 1.00
R4305:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4307:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4308:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4345:Asap2 UTSW 12 21230831 missense probably damaging 1.00
R4525:Asap2 UTSW 12 21229292 splice site probably null
R4562:Asap2 UTSW 12 21112093 missense probably damaging 1.00
R4999:Asap2 UTSW 12 21252765 missense probably benign 0.19
R5221:Asap2 UTSW 12 21213190 missense probably benign 0.14
R5645:Asap2 UTSW 12 21265982 missense probably damaging 0.99
R5799:Asap2 UTSW 12 21168246 missense probably damaging 1.00
R5876:Asap2 UTSW 12 21212809 missense possibly damaging 0.88
R5888:Asap2 UTSW 12 21218190 missense probably damaging 1.00
R5912:Asap2 UTSW 12 21206343 missense probably damaging 1.00
R6576:Asap2 UTSW 12 21244703 missense probably damaging 1.00
R6896:Asap2 UTSW 12 21265525 missense probably damaging 1.00
R6934:Asap2 UTSW 12 21168250 missense probably damaging 1.00
R7134:Asap2 UTSW 12 21265963 nonsense probably null
R7347:Asap2 UTSW 12 21229457 missense probably benign 0.03
R7515:Asap2 UTSW 12 21229239 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ATCTCTGTAGATGATTCTGAGGC -3'
(R):5'- AGCCACACGCCAGTAAGTAG -3'

Sequencing Primer
(F):5'- AGATGATTCTGAGGCTGTCCAG -3'
(R):5'- GCCAGTAAGTAGTCTAACATTCCTC -3'
Posted On2016-06-06