Incidental Mutation 'R0441:Ampd1'
List |< first << previous [record 96 of 1826] next >> last >|
ID39148
Institutional Source Beutler Lab
Gene Symbol Ampd1
Ensembl Gene ENSMUSG00000070385
Gene Nameadenosine monophosphate deaminase 1
SynonymsAmpd-1
MMRRC Submission 038642-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R0441 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103074014-103099720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 103088478 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 235 (L235V)
Ref Sequence ENSEMBL: ENSMUSP00000088217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090715] [ENSMUST00000155034] [ENSMUST00000176440]
Predicted Effect probably benign
Transcript: ENSMUST00000090715
AA Change: L235V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000088217
Gene: ENSMUSG00000070385
AA Change: L235V

DomainStartEndE-ValueType
low complexity region 234 246 N/A INTRINSIC
Pfam:A_deaminase 294 701 5.4e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155034
AA Change: L235V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000143129
Gene: ENSMUSG00000070385
AA Change: L235V

DomainStartEndE-ValueType
low complexity region 234 246 N/A INTRINSIC
Pfam:A_deaminase 294 676 5.2e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176440
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenosine monophosphate deaminase 1 catalyzes the deamination of AMP to IMP in skeletal muscle and plays an important role in the purine nucleotide cycle. Two other genes have been identified, AMPD2 and AMPD3, for the liver- and erythocyte-specific isoforms, respectively. Deficiency of the muscle-specific enzyme is apparently a common cause of exercise-induced myopathy and probably the most common cause of metabolic myopathy in the human. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,492 probably benign Het
Adgrv1 G A 13: 81,397,226 R5647* probably null Het
Agbl2 C T 2: 90,797,483 R211* probably null Het
Akap9 A G 5: 3,961,714 K806E probably benign Het
Atcay T C 10: 81,224,460 D14G possibly damaging Het
Atp8b4 C T 2: 126,378,706 probably benign Het
Bmp8b T C 4: 123,124,515 V393A probably damaging Het
Brca2 T A 5: 150,541,857 D1695E probably damaging Het
Cdh15 A G 8: 122,860,966 I210V probably damaging Het
Cep250 T C 2: 155,972,004 L564P possibly damaging Het
Cmpk1 T C 4: 114,965,023 T110A probably benign Het
Cpsf3 T G 12: 21,300,084 I268S probably damaging Het
Csmd2 C T 4: 128,520,230 A2621V probably benign Het
Cyp2c40 T C 19: 39,807,163 probably benign Het
D430041D05Rik T A 2: 104,167,947 Y1837F probably damaging Het
Degs2 A G 12: 108,702,214 F10S probably damaging Het
Dytn T A 1: 63,678,774 probably benign Het
Elfn2 G C 15: 78,673,595 P251A probably benign Het
Epg5 T C 18: 78,023,271 probably benign Het
Evc2 A G 5: 37,417,467 D1022G probably damaging Het
Fat3 A G 9: 15,945,008 probably benign Het
Fbn1 A T 2: 125,309,755 probably null Het
Gm15217 T C 14: 46,383,219 probably null Het
Gm17611 A T 13: 49,976,399 N30K noncoding transcript Het
Gpld1 G A 13: 24,962,320 W182* probably null Het
Gsc T C 12: 104,473,094 I8V probably damaging Het
Hck A G 2: 153,134,132 K197R probably benign Het
Kat6b T C 14: 21,670,233 L1551P probably damaging Het
Lrch1 C T 14: 74,947,545 G39D possibly damaging Het
Macf1 T C 4: 123,365,355 probably null Het
Mroh9 A T 1: 163,060,762 V248E probably damaging Het
Mrps15 C A 4: 126,051,417 probably benign Het
Mum1 A T 10: 80,229,025 N30Y probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndufa5 T C 6: 24,522,751 T31A probably benign Het
Nfyb A G 10: 82,750,760 V190A possibly damaging Het
Nos2 A G 11: 78,928,583 I40M probably benign Het
Olfr1019 A T 2: 85,841,515 I92N probably damaging Het
Olfr1084 A T 2: 86,639,330 I126K probably damaging Het
Olfr452 T C 6: 42,790,174 I45T probably damaging Het
Otog T C 7: 46,305,877 S2749P probably damaging Het
Pak7 C T 2: 136,116,629 A180T probably benign Het
Pappa2 T C 1: 158,763,058 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxnc1 T A 10: 94,796,482 N1431I probably damaging Het
Prph A T 15: 99,057,438 I429L probably damaging Het
Prrc2a A G 17: 35,149,688 probably benign Het
Rad54b A T 4: 11,563,394 T18S probably benign Het
Ranbp2 A G 10: 58,485,768 E2629G probably benign Het
Rec114 G A 9: 58,657,770 T201I probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec23b A G 2: 144,581,997 E522G probably damaging Het
Sgsm3 G A 15: 81,009,770 R512H possibly damaging Het
Sh3pxd2b C A 11: 32,423,023 A730D possibly damaging Het
Spag4 A G 2: 156,067,979 D281G probably damaging Het
Srgap2 G A 1: 131,336,437 T465I probably damaging Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Tecpr1 C A 5: 144,195,941 R1159L probably benign Het
Tmem63b A T 17: 45,666,315 probably null Het
Tmtc1 T A 6: 148,415,758 D168V probably damaging Het
Tpp2 A G 1: 43,990,562 N68D possibly damaging Het
Ttn C A 2: 76,939,925 A2641S probably benign Het
Uimc1 T C 13: 55,093,219 K19E probably damaging Het
Utrn T A 10: 12,688,294 E1274V probably null Het
Vmn2r102 A T 17: 19,694,368 I732F probably damaging Het
Wrn A T 8: 33,268,750 M792K probably benign Het
Zfp451 A G 1: 33,777,045 I608T probably damaging Het
Other mutations in Ampd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Ampd1 APN 3 103099694 missense possibly damaging 0.64
IGL00909:Ampd1 APN 3 103088428 missense probably benign 0.10
IGL01543:Ampd1 APN 3 103095713 missense probably benign 0.00
IGL01743:Ampd1 APN 3 103094885 unclassified probably benign
IGL02390:Ampd1 APN 3 103079041 missense probably benign 0.28
IGL02637:Ampd1 APN 3 103094883 unclassified probably benign
IGL02735:Ampd1 APN 3 103085377 missense probably damaging 1.00
IGL03151:Ampd1 APN 3 103092470 splice site probably null
R0158:Ampd1 UTSW 3 103091730 nonsense probably null
R0646:Ampd1 UTSW 3 103099597 missense probably damaging 1.00
R1474:Ampd1 UTSW 3 103098838 missense probably damaging 1.00
R1499:Ampd1 UTSW 3 103091664 missense probably damaging 1.00
R1789:Ampd1 UTSW 3 103099126 missense possibly damaging 0.46
R2131:Ampd1 UTSW 3 103094878 critical splice donor site probably null
R3706:Ampd1 UTSW 3 103088311 splice site probably benign
R4007:Ampd1 UTSW 3 103092460 missense probably damaging 0.99
R4169:Ampd1 UTSW 3 103094841 missense probably damaging 1.00
R4525:Ampd1 UTSW 3 103094733 missense probably damaging 1.00
R4828:Ampd1 UTSW 3 103081097 missense probably damaging 1.00
R5015:Ampd1 UTSW 3 103099665 missense possibly damaging 0.89
R5514:Ampd1 UTSW 3 103079172 missense possibly damaging 0.50
R5839:Ampd1 UTSW 3 103085428 missense possibly damaging 0.47
R5872:Ampd1 UTSW 3 103079130 missense probably benign 0.00
R5890:Ampd1 UTSW 3 103090075 missense probably damaging 1.00
R5986:Ampd1 UTSW 3 103085397 missense probably damaging 1.00
R6272:Ampd1 UTSW 3 103085383 missense possibly damaging 0.50
R6473:Ampd1 UTSW 3 103095646 nonsense probably null
R6504:Ampd1 UTSW 3 103099595 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- cagcaatgcctggctCCTAGTTATTT -3'
(R):5'- GAAGGCAGTATTTGACAATGATAAGCATGTGA -3'

Sequencing Primer
(F):5'- cagccagggttacatagtgag -3'
(R):5'- GCATGTGAAAAGCATTCTTATGACC -3'
Posted OnMay 23, 2013