Incidental Mutation 'R5027:Myo7b'
ID391481
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Namemyosin VIIB
Synonyms
MMRRC Submission 042618-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5027 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location31959234-32036961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31975212 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1199 (I1199F)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
Predicted Effect probably benign
Transcript: ENSMUST00000134663
AA Change: I1199F

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: I1199F

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Meta Mutation Damage Score 0.3368 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
Abca14 T G 7: 120,312,282 I1363R probably benign Het
Abcc1 T C 16: 14,404,053 probably null Het
Adgrf1 T A 17: 43,303,747 F241I probably damaging Het
Afg3l1 T C 8: 123,489,814 M264T probably benign Het
Ankle1 T C 8: 71,408,979 S434P probably damaging Het
Apoe C T 7: 19,697,015 A101T probably damaging Het
Apol11a G T 15: 77,516,953 K213N probably damaging Het
Asap2 A G 12: 21,204,081 M198V probably damaging Het
Atg4b C T 1: 93,786,575 A360V probably benign Het
B3gnt5 T A 16: 19,769,694 V221D probably damaging Het
Baz2b A T 2: 60,098,644 probably benign Het
Cep350 C A 1: 155,933,354 W492L probably benign Het
Cln6 A G 9: 62,847,093 Y139C probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cul9 C T 17: 46,500,782 E2507K probably damaging Het
Ddx58 T A 4: 40,208,845 M756L probably benign Het
Dgkz A T 2: 91,945,543 V125D probably benign Het
Dnah17 T C 11: 118,102,539 M1127V probably benign Het
Dnajb1 C A 8: 83,610,103 D67E probably benign Het
Dync1li1 A G 9: 114,713,544 D258G probably damaging Het
Egflam G T 15: 7,253,644 P311T probably benign Het
Fbxw11 T A 11: 32,652,811 probably benign Het
Fn3krp T G 11: 121,429,448 D206E probably benign Het
Fsip2 A G 2: 82,989,133 H5070R possibly damaging Het
Gm6169 A G 13: 97,099,140 I33T probably benign Het
Gm6605 T C 7: 38,450,259 noncoding transcript Het
Gna14 C A 19: 16,603,272 T158K probably benign Het
Gstt2 A T 10: 75,831,892 I243N probably damaging Het
Haus6 C T 4: 86,605,696 D50N possibly damaging Het
Hcrtr2 A G 9: 76,323,296 I70T probably benign Het
Herc1 G A 9: 66,473,529 V3563I probably benign Het
Herc1 A T 9: 66,504,618 I4707F probably damaging Het
Hic2 C T 16: 17,258,747 A480V possibly damaging Het
Hsd17b3 A G 13: 64,062,906 Y212H probably damaging Het
Hspa5 A G 2: 34,775,815 K557R probably damaging Het
Iqch T C 9: 63,525,012 E367G possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lars2 A G 9: 123,441,495 M551V probably benign Het
Lbp T C 2: 158,308,726 I57T possibly damaging Het
Litaf T C 16: 10,961,004 Q142R possibly damaging Het
Lpar5 G C 6: 125,082,147 R277P possibly damaging Het
Muc6 T A 7: 141,636,436 I2710F probably benign Het
Naca A C 10: 128,048,121 E2140D possibly damaging Het
Nup214 G T 2: 31,991,317 G396C probably damaging Het
Olfr1052 G A 2: 86,298,196 V127I possibly damaging Het
Olfr259 T A 2: 87,107,806 I194F probably benign Het
Olfr56 A T 11: 49,134,624 Q144L probably benign Het
Olfr853 A G 9: 19,537,277 Y218H probably damaging Het
Olfr983 A T 9: 40,092,394 S187T probably damaging Het
P4htm A G 9: 108,579,293 V436A probably benign Het
Pfkm A G 15: 98,119,426 I117V possibly damaging Het
Phlpp1 T G 1: 106,281,471 V518G probably damaging Het
Piwil4 G A 9: 14,709,944 L598F probably damaging Het
Polr1b T G 2: 129,123,883 I815R possibly damaging Het
Ppef2 T C 5: 92,234,291 N515S probably damaging Het
Prpsap2 G T 11: 61,741,004 probably null Het
Rab27a A G 9: 73,095,413 D208G probably benign Het
Ralgds A G 2: 28,552,090 probably null Het
Raph1 C A 1: 60,496,277 C540F probably damaging Het
Rbsn A G 6: 92,198,250 L281P probably damaging Het
Rmdn1 G T 4: 19,588,533 G110* probably null Het
Rph3a T A 5: 120,954,449 E363V possibly damaging Het
Serpina16 G T 12: 103,675,003 Y154* probably null Het
Sh2d3c G A 2: 32,744,802 E198K possibly damaging Het
Shank2 C A 7: 144,259,105 Y663* probably null Het
Sharpin T C 15: 76,350,025 probably benign Het
Slitrk1 G A 14: 108,912,308 P324S probably benign Het
Sorbs2 T A 8: 45,746,534 probably null Het
Spag16 C T 1: 69,923,804 probably benign Het
Sycp2l A T 13: 41,129,771 probably null Het
Synj1 A T 16: 90,940,519 probably null Het
Sytl1 T C 4: 133,256,219 probably benign Het
Tkfc A T 19: 10,592,659 probably null Het
Tnn T C 1: 160,145,211 T274A probably damaging Het
Trav14-2 T A 14: 53,641,048 W35R probably damaging Het
Trim72 T C 7: 128,007,965 M222T probably damaging Het
Trim9 A G 12: 70,346,708 V154A probably damaging Het
Ttc7b T C 12: 100,301,742 Y266C probably damaging Het
Uchl3 T A 14: 101,666,546 I43K possibly damaging Het
Vdac1 T A 11: 52,388,478 N269K possibly damaging Het
Wdr72 T A 9: 74,145,976 W187R probably damaging Het
Zfp30 T A 7: 29,793,066 C248* probably null Het
Zfp940 A T 7: 29,850,956 probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31959466 missense possibly damaging 0.80
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 unclassified probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1623:Myo7b UTSW 18 32000051 missense probably damaging 1.00
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2027:Myo7b UTSW 18 31984960 missense probably benign
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4765:Myo7b UTSW 18 31961900 missense probably benign 0.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5267:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6137:Myo7b UTSW 18 31999974 missense probably damaging 1.00
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6302:Myo7b UTSW 18 31994386 missense probably damaging 0.98
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R8030:Myo7b UTSW 18 31998082 missense not run
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense not run
Z1177:Myo7b UTSW 18 31985056 missense not run
Predicted Primers PCR Primer
(F):5'- ACAGATTCTGGCTTCAGGGTG -3'
(R):5'- TGGACACCATGCCAATTCGC -3'

Sequencing Primer
(F):5'- TCTGGCCCAGGTGTGCATAG -3'
(R):5'- ATTCGCAATCAGACCCTGGG -3'
Posted On2016-06-06