Incidental Mutation 'R5028:Camsap1'
ID391491
Institutional Source Beutler Lab
Gene Symbol Camsap1
Ensembl Gene ENSMUSG00000026933
Gene Namecalmodulin regulated spectrin-associated protein 1
Synonyms9530003A05Rik, PRO2405
MMRRC Submission 042619-MU
Accession Numbers

Genbank: NM_001115076; MGI: 3036242

Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R5028 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25926838-25983282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25944556 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 364 (S364P)
Ref Sequence ENSEMBL: ENSMUSP00000139028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091268] [ENSMUST00000114167] [ENSMUST00000134882] [ENSMUST00000183461]
Predicted Effect probably damaging
Transcript: ENSMUST00000091268
AA Change: S364P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088812
Gene: ENSMUSG00000026933
AA Change: S364P

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 228 311 3.3e-35 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
Pfam:CAMSAP_CC1 859 917 3.8e-29 PFAM
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114167
AA Change: S364P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109804
Gene: ENSMUSG00000026933
AA Change: S364P

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134054
SMART Domains Protein: ENSMUSP00000121689
Gene: ENSMUSG00000026933

DomainStartEndE-ValueType
Blast:Beach 40 100 5e-6 BLAST
Pfam:CAMSAP_CH 170 253 1.4e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134882
AA Change: S384P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117203
Gene: ENSMUSG00000026933
AA Change: S384P

DomainStartEndE-ValueType
Pfam:CH 185 350 1.3e-33 PFAM
Pfam:CAMSAP_CH 248 331 2.6e-34 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
coiled coil region 889 925 N/A INTRINSIC
coiled coil region 1030 1057 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142028
SMART Domains Protein: ENSMUSP00000119296
Gene: ENSMUSG00000026933

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 101 164 7.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143977
Predicted Effect probably benign
Transcript: ENSMUST00000151593
SMART Domains Protein: ENSMUSP00000123541
Gene: ENSMUSG00000026933

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 88 171 5.7e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183461
AA Change: S364P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139028
Gene: ENSMUSG00000026933
AA Change: S364P

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Meta Mutation Damage Score 0.2039 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (62/64)
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,274,012 S777C probably damaging Het
Ano5 T A 7: 51,537,710 probably null Het
Arhgap17 T A 7: 123,294,673 H508L probably benign Het
Arhgap29 T A 3: 122,010,060 probably null Het
Atp12a T C 14: 56,386,978 F961S probably damaging Het
B4galnt4 C A 7: 141,068,062 P497Q probably benign Het
Ccdc150 C A 1: 54,263,477 D85E probably benign Het
Cdc45 A G 16: 18,795,180 Y291H probably benign Het
Comp A C 8: 70,376,640 N289T probably damaging Het
Cops3 T A 11: 59,818,030 probably benign Het
Crybg1 G A 10: 43,998,212 H967Y possibly damaging Het
Csmd1 A T 8: 15,989,090 F2423I probably damaging Het
Dact1 C A 12: 71,318,573 C709* probably null Het
Dcxr T G 11: 120,726,447 Q90P probably damaging Het
Ell A G 8: 70,590,699 Y494C probably damaging Het
Emilin2 T C 17: 71,274,732 E333G possibly damaging Het
Eml2 T C 7: 19,179,447 probably null Het
Fam186b T A 15: 99,280,801 M215L probably damaging Het
Gm17078 T A 14: 51,611,242 R13W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hspa14 A G 2: 3,498,169 F196S possibly damaging Het
Ier5 A G 1: 155,099,103 S110P possibly damaging Het
Kif1a T A 1: 93,054,327 I793F possibly damaging Het
Lrrc43 T C 5: 123,508,113 I643T probably damaging Het
Map3k19 A T 1: 127,823,232 L794Q probably benign Het
Meox2 A T 12: 37,108,936 M36L probably benign Het
Mgat5b T A 11: 116,985,029 L693Q probably damaging Het
Mup4 T A 4: 59,958,124 E148V possibly damaging Het
Napb T C 2: 148,703,137 N162S possibly damaging Het
Nlgn2 T C 11: 69,827,737 D339G probably benign Het
Nucks1 C T 1: 131,928,102 R90C possibly damaging Het
Olfr1431 T A 19: 12,210,154 V196E possibly damaging Het
Olfr740 T C 14: 50,453,739 V229A probably damaging Het
Plekhd1 A T 12: 80,692,949 D24V probably damaging Het
Prpf4b C T 13: 34,899,975 P909L probably damaging Het
Rasgrp1 T A 2: 117,302,004 K116* probably null Het
Ror1 A G 4: 100,411,936 T324A possibly damaging Het
Slc24a4 G A 12: 102,264,370 G505R probably damaging Het
Slc8a1 A G 17: 81,649,273 I112T possibly damaging Het
Smarcc2 A G 10: 128,461,445 S69G probably damaging Het
Smc2 A T 4: 52,458,447 E429D probably damaging Het
Sry T C Y: 2,663,312 D116G probably damaging Het
Tcea3 T A 4: 136,257,935 V154E possibly damaging Het
Tigd2 G A 6: 59,211,220 W357* probably null Het
Tmem177 T A 1: 119,910,689 T87S probably benign Het
Treh A T 9: 44,682,889 E144V probably null Het
Trpm6 T A 19: 18,786,760 D243E probably damaging Het
Ttn T C 2: 76,778,050 D17843G probably damaging Het
Vars2 A C 17: 35,659,473 probably null Het
Vmn1r201 G A 13: 22,475,360 W248* probably null Het
Yap1 T C 9: 8,001,689 T99A probably benign Het
Zbtb8b C A 4: 129,433,000 C91F probably damaging Het
Zfp882 A G 8: 71,914,654 T442A possibly damaging Het
Zxdc G T 6: 90,382,338 G651C probably benign Het
Other mutations in Camsap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Camsap1 APN 2 25933623 missense possibly damaging 0.95
IGL01555:Camsap1 APN 2 25939393 missense possibly damaging 0.81
IGL01667:Camsap1 APN 2 25945281 splice site probably benign
IGL02167:Camsap1 APN 2 25934300 missense probably damaging 1.00
IGL02191:Camsap1 APN 2 25929880 missense probably damaging 0.97
IGL02285:Camsap1 APN 2 25929802 missense probably damaging 1.00
IGL02393:Camsap1 APN 2 25938322 missense probably benign 0.10
3-1:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R0631:Camsap1 UTSW 2 25933647 missense probably damaging 0.98
R0828:Camsap1 UTSW 2 25939085 missense probably damaging 1.00
R1434:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R1687:Camsap1 UTSW 2 25939615 missense probably damaging 1.00
R2027:Camsap1 UTSW 2 25938526 missense possibly damaging 0.51
R2048:Camsap1 UTSW 2 25929743 missense probably benign 0.00
R3732:Camsap1 UTSW 2 25938344 missense probably damaging 1.00
R4437:Camsap1 UTSW 2 25938646 missense possibly damaging 0.89
R4494:Camsap1 UTSW 2 25952758 missense probably damaging 1.00
R4888:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5058:Camsap1 UTSW 2 25939363 missense probably benign 0.01
R5105:Camsap1 UTSW 2 25940929 missense probably damaging 1.00
R5121:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5153:Camsap1 UTSW 2 25933618 missense probably damaging 1.00
R5323:Camsap1 UTSW 2 25965811 missense probably damaging 0.98
R6043:Camsap1 UTSW 2 25929925 missense probably benign 0.00
R6479:Camsap1 UTSW 2 25935862 missense possibly damaging 0.88
R6502:Camsap1 UTSW 2 25956308 missense probably damaging 1.00
R6571:Camsap1 UTSW 2 25939500 missense possibly damaging 0.89
R7046:Camsap1 UTSW 2 25945189 missense probably damaging 0.99
R7251:Camsap1 UTSW 2 25938886 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCATTCTCAGGCTATCATGTAAAAGG -3'
(R):5'- AAGTCAGCCTAGAGCCTCAC -3'

Sequencing Primer
(F):5'- GAAAGAAGATGGTAAACTGGCCAC -3'
(R):5'- GCCTAGAGCCTCACCTGTTAAAC -3'
Posted On2016-06-06