Mutagenetix > Incidental Mutations

Incidental Mutation 'R5028:Rasgrp1'

391494

Institutional Source

Beutler Lab

Gene Symbol

Rasgrp1

Ensembl Gene

ENSMUSG00000027347

Gene Name

RAS guanyl releasing protein 1

Synonyms

MMRRC Submission

042619-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.302) question?

Stock #

R5028 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

117279993-117343001 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 117302004 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 116 (K116*)

Ref Sequence

ENSEMBL: ENSMUSP00000136423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102534] [ENSMUST00000172901] [ENSMUST00000173252] [ENSMUST00000173541] [ENSMUST00000174770] [ENSMUST00000178884]

Predicted Effect

probably null
Transcript: ENSMUST00000102534
AA Change: K116*

SMART Domains

Protein: ENSMUSP00000099593
Gene: ENSMUSG00000027347
AA Change: K116*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	474	499	3.2e-6	PFAM
Pfam:EF-hand_6	474	502	5e-6	PFAM
C1	542	591	5.77e-16	SMART
PDB:4L9U\|B	740	791	2e-23	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000110898

Predicted Effect

probably null
Transcript: ENSMUST00000172901
AA Change: K116*

SMART Domains

Protein: ENSMUSP00000133449
Gene: ENSMUSG00000027347
AA Change: K116*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_6	442	467	1.2e-5	PFAM
C1	507	556	5.77e-16	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000173252
AA Change: K116*

SMART Domains

Protein: ENSMUSP00000134592
Gene: ENSMUSG00000027347
AA Change: K116*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_6	442	467	1.1e-5	PFAM
Pfam:C1_1	507	539	3.4e-8	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000173541
AA Change: K116*

SMART Domains

Protein: ENSMUSP00000134027
Gene: ENSMUSG00000027347
AA Change: K116*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	441	464	1.6e-5	PFAM
Pfam:EF-hand_6	442	467	1.6e-5	PFAM
C1	507	556	5.77e-16	SMART
PDB:4L9U\|B	705	756	2e-23	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000174770
AA Change: K116*

SMART Domains

Protein: ENSMUSP00000134167
Gene: ENSMUSG00000027347
AA Change: K116*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000178884
AA Change: K116*

SMART Domains

Protein: ENSMUSP00000136423
Gene: ENSMUSG00000027347
AA Change: K116*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	474	499	3.2e-6	PFAM
C1	542	591	5.77e-16	SMART
PDB:4L9U\|B	740	791	2e-23	PDB

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

97% (62/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes characterized by the presence of a Ras superfamily guanine nucleotide exchange factor (GEF) domain. It functions as a diacylglycerol (DAG)-regulated nucleotide exchange factor specifically activating Ras through the exchange of bound GDP for GTP. It activates the Erk/MAP kinase cascade and regulates T-cells and B-cells development, homeostasis and differentiation. Alternatively spliced transcript variants encoding different isoforms have been identified. Altered expression of the different isoforms of this protein may be a cause of susceptibility to systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous and targeted null mutations exhibit a lymphoproliferative autoimmune syndrome in which T cells fail to activate Ras or proliferate after antigen exposure, defects in positive selection, and enlarged spleen and lymph nodes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	T	A	2: 69,274,012	S777C	probably damaging	Het
Ano5	T	A	7: 51,537,710		probably null	Het
Arhgap17	T	A	7: 123,294,673	H508L	probably benign	Het
Arhgap29	T	A	3: 122,010,060		probably null	Het
Atp12a	T	C	14: 56,386,978	F961S	probably damaging	Het
B4galnt4	C	A	7: 141,068,062	P497Q	probably benign	Het
Camsap1	A	G	2: 25,944,556	S364P	probably damaging	Het
Ccdc150	C	A	1: 54,263,477	D85E	probably benign	Het
Cdc45	A	G	16: 18,795,180	Y291H	probably benign	Het
Comp	A	C	8: 70,376,640	N289T	probably damaging	Het
Cops3	T	A	11: 59,818,030		probably benign	Het
Crybg1	G	A	10: 43,998,212	H967Y	possibly damaging	Het
Csmd1	A	T	8: 15,989,090	F2423I	probably damaging	Het
Dact1	C	A	12: 71,318,573	C709*	probably null	Het
Dcxr	T	G	11: 120,726,447	Q90P	probably damaging	Het
Ell	A	G	8: 70,590,699	Y494C	probably damaging	Het
Emilin2	T	C	17: 71,274,732	E333G	possibly damaging	Het
Eml2	T	C	7: 19,179,447		probably null	Het
Fam186b	T	A	15: 99,280,801	M215L	probably damaging	Het
Gm17078	T	A	14: 51,611,242	R13W	probably null	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Hspa14	A	G	2: 3,498,169	F196S	possibly damaging	Het
Ier5	A	G	1: 155,099,103	S110P	possibly damaging	Het
Kif1a	T	A	1: 93,054,327	I793F	possibly damaging	Het
Lrrc43	T	C	5: 123,508,113	I643T	probably damaging	Het
Map3k19	A	T	1: 127,823,232	L794Q	probably benign	Het
Meox2	A	T	12: 37,108,936	M36L	probably benign	Het
Mgat5b	T	A	11: 116,985,029	L693Q	probably damaging	Het
Mup4	T	A	4: 59,958,124	E148V	possibly damaging	Het
Napb	T	C	2: 148,703,137	N162S	possibly damaging	Het
Nlgn2	T	C	11: 69,827,737	D339G	probably benign	Het
Nucks1	C	T	1: 131,928,102	R90C	possibly damaging	Het
Olfr1431	T	A	19: 12,210,154	V196E	possibly damaging	Het
Olfr740	T	C	14: 50,453,739	V229A	probably damaging	Het
Plekhd1	A	T	12: 80,692,949	D24V	probably damaging	Het
Prpf4b	C	T	13: 34,899,975	P909L	probably damaging	Het
Ror1	A	G	4: 100,411,936	T324A	possibly damaging	Het
Slc24a4	G	A	12: 102,264,370	G505R	probably damaging	Het
Slc8a1	A	G	17: 81,649,273	I112T	possibly damaging	Het
Smarcc2	A	G	10: 128,461,445	S69G	probably damaging	Het
Smc2	A	T	4: 52,458,447	E429D	probably damaging	Het
Sry	T	C	Y: 2,663,312	D116G	probably damaging	Het
Tcea3	T	A	4: 136,257,935	V154E	possibly damaging	Het
Tigd2	G	A	6: 59,211,220	W357*	probably null	Het
Tmem177	T	A	1: 119,910,689	T87S	probably benign	Het
Treh	A	T	9: 44,682,889	E144V	probably null	Het
Trpm6	T	A	19: 18,786,760	D243E	probably damaging	Het
Ttn	T	C	2: 76,778,050	D17843G	probably damaging	Het
Vars2	A	C	17: 35,659,473		probably null	Het
Vmn1r201	G	A	13: 22,475,360	W248*	probably null	Het
Yap1	T	C	9: 8,001,689	T99A	probably benign	Het
Zbtb8b	C	A	4: 129,433,000	C91F	probably damaging	Het
Zfp882	A	G	8: 71,914,654	T442A	possibly damaging	Het
Zxdc	G	T	6: 90,382,338	G651C	probably benign	Het

Other mutations in Rasgrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Rasgrp1	APN	2	117305791	nonsense	probably null
IGL00901:Rasgrp1	APN	2	117285130	missense	probably damaging	0.96
IGL01083:Rasgrp1	APN	2	117285068	missense	probably benign	0.22
IGL01325:Rasgrp1	APN	2	117298529	missense	probably damaging	1.00
IGL01520:Rasgrp1	APN	2	117288663	missense	probably damaging	1.00
IGL01776:Rasgrp1	APN	2	117286840	critical splice donor site	probably null
IGL01780:Rasgrp1	APN	2	117284878	missense	probably benign	0.00
IGL01859:Rasgrp1	APN	2	117289418	missense	probably benign	0.00
IGL01892:Rasgrp1	APN	2	117293842	missense	probably damaging	1.00
IGL02068:Rasgrp1	APN	2	117300578	splice site	probably benign
IGL02684:Rasgrp1	APN	2	117282576	missense	probably benign	0.03
bukhansan	UTSW	2	117291697	missense	possibly damaging	0.78
grouper	UTSW	2	117302004	nonsense	probably null
Gyeryandsan	UTSW	2	117287943	missense	probably damaging	1.00
Haddock	UTSW	2	117291895	missense	probably damaging	0.99
mercurial	UTSW	2	117287833	nonsense	probably null
naejangsan	UTSW	2	117291792	nonsense	probably null
sea_bass	UTSW	2	117282654	missense	probably benign	0.02
venutian	UTSW	2	117284929	nonsense	probably null
R0067:Rasgrp1	UTSW	2	117294820	missense	probably damaging	1.00
R0067:Rasgrp1	UTSW	2	117294820	missense	probably damaging	1.00
R0538:Rasgrp1	UTSW	2	117284947	missense	probably benign	0.42
R0786:Rasgrp1	UTSW	2	117300499	missense	probably benign
R1068:Rasgrp1	UTSW	2	117282576	missense	probably benign	0.03
R1165:Rasgrp1	UTSW	2	117284939	missense	possibly damaging	0.49
R1491:Rasgrp1	UTSW	2	117282619	nonsense	probably null
R1707:Rasgrp1	UTSW	2	117298547	missense	probably damaging	1.00
R1869:Rasgrp1	UTSW	2	117290347	missense	probably damaging	1.00
R2214:Rasgrp1	UTSW	2	117285165	missense	probably damaging	0.98
R2425:Rasgrp1	UTSW	2	117289450	critical splice acceptor site	probably null
R3236:Rasgrp1	UTSW	2	117291812	missense	probably benign	0.00
R3915:Rasgrp1	UTSW	2	117288641	missense	probably damaging	1.00
R4079:Rasgrp1	UTSW	2	117285029	missense	probably benign	0.19
R4163:Rasgrp1	UTSW	2	117282654	missense	probably benign	0.02
R4781:Rasgrp1	UTSW	2	117291709	missense	probably benign	0.04
R4782:Rasgrp1	UTSW	2	117284875	missense	probably benign	0.00
R6019:Rasgrp1	UTSW	2	117291895	missense	probably damaging	0.99
R6220:Rasgrp1	UTSW	2	117284929	nonsense	probably null
R6294:Rasgrp1	UTSW	2	117291792	nonsense	probably null
R6335:Rasgrp1	UTSW	2	117293870	missense	probably damaging	0.99
R6948:Rasgrp1	UTSW	2	117298604	missense	probably damaging	0.99
R7165:Rasgrp1	UTSW	2	117338404	missense	probably benign	0.02
R7246:Rasgrp1	UTSW	2	117338354	nonsense	probably null
R7372:Rasgrp1	UTSW	2	117285154	missense	probably benign	0.01
R7400:Rasgrp1	UTSW	2	117298545	missense	probably damaging	1.00
R7432:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7448:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7448:Rasgrp1	UTSW	2	117291697	missense	possibly damaging	0.78
R7449:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7450:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7475:Rasgrp1	UTSW	2	117286108	missense	probably benign
R7487:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7573:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7672:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R8016:Rasgrp1	UTSW	2	117287833	nonsense	probably null
R8199:Rasgrp1	UTSW	2	117293812	missense	probably damaging	1.00
R8527:Rasgrp1	UTSW	2	117338304	missense	probably benign	0.07
Z1176:Rasgrp1	UTSW	2	117301974	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCAGTGTGAGGAAGCCTACAC -3'
(R):5'- ACTGCCTAGTTATGCATACATCAG -3'

Sequencing Primer
(F):5'- CCTACACAAGGCTGGGAGG -3'
(R):5'- GACAAAAGGGATCTCTTTCTAACTC -3'

Posted On

2016-06-06