Incidental Mutation 'R5028:Lrrc43'
ID391502
Institutional Source Beutler Lab
Gene Symbol Lrrc43
Ensembl Gene ENSMUSG00000063409
Gene Nameleucine rich repeat containing 43
SynonymsLOC381741
MMRRC Submission 042619-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5028 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location123489305-123508205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123508113 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 643 (I643T)
Ref Sequence ENSEMBL: ENSMUSP00000113933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031384] [ENSMUST00000094327] [ENSMUST00000111587] [ENSMUST00000121444] [ENSMUST00000125652] [ENSMUST00000139398] [ENSMUST00000196809] [ENSMUST00000197682] [ENSMUST00000200247]
Predicted Effect probably benign
Transcript: ENSMUST00000031384
SMART Domains Protein: ENSMUSP00000031384
Gene: ENSMUSG00000029431

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Galactosyl_T 106 297 1.3e-43 PFAM
Pfam:Fringe 169 302 2.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094327
AA Change: I650T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091885
Gene: ENSMUSG00000063409
AA Change: I650T

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 3e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 537 565 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111587
SMART Domains Protein: ENSMUSP00000107214
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 9 237 4.1e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121444
AA Change: I643T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113933
Gene: ENSMUSG00000063409
AA Change: I643T

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 4e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 530 558 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125652
SMART Domains Protein: ENSMUSP00000115045
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 6 237 1.1e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134552
Predicted Effect probably benign
Transcript: ENSMUST00000139398
SMART Domains Protein: ENSMUSP00000143485
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 6 150 7.1e-68 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000196809
AA Change: S643P
SMART Domains Protein: ENSMUSP00000143602
Gene: ENSMUSG00000063409
AA Change: S643P

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 2e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 537 565 N/A INTRINSIC
low complexity region 635 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197682
Predicted Effect probably benign
Transcript: ENSMUST00000200247
SMART Domains Protein: ENSMUSP00000143673
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 1 109 4.4e-57 PFAM
Meta Mutation Damage Score 0.2681 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (62/64)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,274,012 S777C probably damaging Het
Ano5 T A 7: 51,537,710 probably null Het
Arhgap17 T A 7: 123,294,673 H508L probably benign Het
Arhgap29 T A 3: 122,010,060 probably null Het
Atp12a T C 14: 56,386,978 F961S probably damaging Het
B4galnt4 C A 7: 141,068,062 P497Q probably benign Het
Camsap1 A G 2: 25,944,556 S364P probably damaging Het
Ccdc150 C A 1: 54,263,477 D85E probably benign Het
Cdc45 A G 16: 18,795,180 Y291H probably benign Het
Comp A C 8: 70,376,640 N289T probably damaging Het
Cops3 T A 11: 59,818,030 probably benign Het
Crybg1 G A 10: 43,998,212 H967Y possibly damaging Het
Csmd1 A T 8: 15,989,090 F2423I probably damaging Het
Dact1 C A 12: 71,318,573 C709* probably null Het
Dcxr T G 11: 120,726,447 Q90P probably damaging Het
Ell A G 8: 70,590,699 Y494C probably damaging Het
Emilin2 T C 17: 71,274,732 E333G possibly damaging Het
Eml2 T C 7: 19,179,447 probably null Het
Fam186b T A 15: 99,280,801 M215L probably damaging Het
Gm17078 T A 14: 51,611,242 R13W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hspa14 A G 2: 3,498,169 F196S possibly damaging Het
Ier5 A G 1: 155,099,103 S110P possibly damaging Het
Kif1a T A 1: 93,054,327 I793F possibly damaging Het
Map3k19 A T 1: 127,823,232 L794Q probably benign Het
Meox2 A T 12: 37,108,936 M36L probably benign Het
Mgat5b T A 11: 116,985,029 L693Q probably damaging Het
Mup4 T A 4: 59,958,124 E148V possibly damaging Het
Napb T C 2: 148,703,137 N162S possibly damaging Het
Nlgn2 T C 11: 69,827,737 D339G probably benign Het
Nucks1 C T 1: 131,928,102 R90C possibly damaging Het
Olfr1431 T A 19: 12,210,154 V196E possibly damaging Het
Olfr740 T C 14: 50,453,739 V229A probably damaging Het
Plekhd1 A T 12: 80,692,949 D24V probably damaging Het
Prpf4b C T 13: 34,899,975 P909L probably damaging Het
Rasgrp1 T A 2: 117,302,004 K116* probably null Het
Ror1 A G 4: 100,411,936 T324A possibly damaging Het
Slc24a4 G A 12: 102,264,370 G505R probably damaging Het
Slc8a1 A G 17: 81,649,273 I112T possibly damaging Het
Smarcc2 A G 10: 128,461,445 S69G probably damaging Het
Smc2 A T 4: 52,458,447 E429D probably damaging Het
Sry T C Y: 2,663,312 D116G probably damaging Het
Tcea3 T A 4: 136,257,935 V154E possibly damaging Het
Tigd2 G A 6: 59,211,220 W357* probably null Het
Tmem177 T A 1: 119,910,689 T87S probably benign Het
Treh A T 9: 44,682,889 E144V probably null Het
Trpm6 T A 19: 18,786,760 D243E probably damaging Het
Ttn T C 2: 76,778,050 D17843G probably damaging Het
Vars2 A C 17: 35,659,473 probably null Het
Vmn1r201 G A 13: 22,475,360 W248* probably null Het
Yap1 T C 9: 8,001,689 T99A probably benign Het
Zbtb8b C A 4: 129,433,000 C91F probably damaging Het
Zfp882 A G 8: 71,914,654 T442A possibly damaging Het
Zxdc G T 6: 90,382,338 G651C probably benign Het
Other mutations in Lrrc43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02123:Lrrc43 APN 5 123494279 missense probably damaging 1.00
IGL02364:Lrrc43 APN 5 123501212 missense possibly damaging 0.77
PIT4520001:Lrrc43 UTSW 5 123492467 missense possibly damaging 0.93
R0019:Lrrc43 UTSW 5 123501315 missense probably damaging 1.00
R0279:Lrrc43 UTSW 5 123497022 splice site probably null
R0523:Lrrc43 UTSW 5 123501242 missense probably damaging 1.00
R1723:Lrrc43 UTSW 5 123492213 unclassified probably benign
R2104:Lrrc43 UTSW 5 123501114 missense probably benign 0.00
R2213:Lrrc43 UTSW 5 123503577 missense possibly damaging 0.94
R2269:Lrrc43 UTSW 5 123503291 missense probably damaging 1.00
R4591:Lrrc43 UTSW 5 123501164 missense probably benign 0.00
R4629:Lrrc43 UTSW 5 123499520 missense probably damaging 1.00
R4727:Lrrc43 UTSW 5 123494303 missense probably damaging 1.00
R4941:Lrrc43 UTSW 5 123501063 missense probably benign 0.01
R4960:Lrrc43 UTSW 5 123499612 missense probably benign 0.19
R5387:Lrrc43 UTSW 5 123499671 splice site probably null
R5653:Lrrc43 UTSW 5 123499580 missense probably damaging 1.00
R6266:Lrrc43 UTSW 5 123503277 missense probably damaging 1.00
R6323:Lrrc43 UTSW 5 123503886 missense probably damaging 1.00
R6703:Lrrc43 UTSW 5 123499469 missense possibly damaging 0.94
R6869:Lrrc43 UTSW 5 123504276 critical splice donor site probably null
R6909:Lrrc43 UTSW 5 123500419 missense probably benign 0.14
R7023:Lrrc43 UTSW 5 123503763 missense probably damaging 1.00
X0024:Lrrc43 UTSW 5 123501318 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTTTCGGAATTCCTCTAGGTTGGAG -3'
(R):5'- TATCCAGGACGCACTTGTGG -3'

Sequencing Primer
(F):5'- AGAACAGGGCTTGAATTCCC -3'
(R):5'- GCTCGTTGGCAACTGCAAC -3'
Posted On2016-06-06