Mutagenetix > Incidental Mutations

Incidental Mutation 'R5028:Comp'

391512

Institutional Source

Beutler Lab

Gene Symbol

Comp

Ensembl Gene

ENSMUSG00000031849

Gene Name

cartilage oligomeric matrix protein

Synonyms

thrombospondin-5, TSP5

MMRRC Submission

042619-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R5028 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70373558-70382066 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 70376640 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 289 (N289T)

Ref Sequence

ENSEMBL: ENSMUSP00000003659 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003659]

PDB Structure

Storage function of COMP:the crystal structure of the coiled-coil domain in complex with vitamin D3 [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000003659
AA Change: N289T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000003659
Gene: ENSMUSG00000031849
AA Change: N289T

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:COMP	28	72	6.2e-22	PFAM
EGF	88	124	8.19e-2	SMART
EGF_CA	125	177	5.08e-7	SMART
EGF_CA	178	220	1.73e-9	SMART
EGF	226	265	7.53e-1	SMART
Pfam:TSP_3	299	334	6.1e-16	PFAM
Pfam:TSP_3	358	393	1.2e-15	PFAM
Pfam:TSP_3	393	416	2.7e-6	PFAM
Pfam:TSP_3	417	454	1.6e-14	PFAM
Pfam:TSP_3	455	490	3.7e-14	PFAM
Pfam:TSP_3	491	526	6.1e-15	PFAM
Pfam:TSP_C	544	741	2.6e-101	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212439

Predicted Effect

probably benign
Transcript: ENSMUST00000212488

Predicted Effect

probably benign
Transcript: ENSMUST00000213072

Meta Mutation Damage Score

0.1583

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

97% (62/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a noncollagenous extracellular matrix (ECM) protein. It consists of five identical glycoprotein subunits, each with EGF-like and calcium-binding (thrombospondin-like) domains. Oligomerization results from formation of a five-stranded coiled coil and disulfides. Binding to other ECM proteins such as collagen appears to depend on divalent cations. Contraction or expansion of a 5 aa aspartate repeat and other mutations can cause pseudochondroplasia (PSACH) and multiple epiphyseal dysplasia (MED). [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation are indistinguishable from controls. Mice homozygous for a knockin allele with two point mutations exhibit short limb dwarfism, osteoarthritis, abnormal chondrocytes, mild myopathy, and abnormal tendon morphology and stiffness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	T	A	2: 69,274,012	S777C	probably damaging	Het
Ano5	T	A	7: 51,537,710		probably null	Het
Arhgap17	T	A	7: 123,294,673	H508L	probably benign	Het
Arhgap29	T	A	3: 122,010,060		probably null	Het
Atp12a	T	C	14: 56,386,978	F961S	probably damaging	Het
B4galnt4	C	A	7: 141,068,062	P497Q	probably benign	Het
Camsap1	A	G	2: 25,944,556	S364P	probably damaging	Het
Ccdc150	C	A	1: 54,263,477	D85E	probably benign	Het
Cdc45	A	G	16: 18,795,180	Y291H	probably benign	Het
Cops3	T	A	11: 59,818,030		probably benign	Het
Crybg1	G	A	10: 43,998,212	H967Y	possibly damaging	Het
Csmd1	A	T	8: 15,989,090	F2423I	probably damaging	Het
Dact1	C	A	12: 71,318,573	C709*	probably null	Het
Dcxr	T	G	11: 120,726,447	Q90P	probably damaging	Het
Ell	A	G	8: 70,590,699	Y494C	probably damaging	Het
Emilin2	T	C	17: 71,274,732	E333G	possibly damaging	Het
Eml2	T	C	7: 19,179,447		probably null	Het
Fam186b	T	A	15: 99,280,801	M215L	probably damaging	Het
Gm17078	T	A	14: 51,611,242	R13W	probably null	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Hspa14	A	G	2: 3,498,169	F196S	possibly damaging	Het
Ier5	A	G	1: 155,099,103	S110P	possibly damaging	Het
Kif1a	T	A	1: 93,054,327	I793F	possibly damaging	Het
Lrrc43	T	C	5: 123,508,113	I643T	probably damaging	Het
Map3k19	A	T	1: 127,823,232	L794Q	probably benign	Het
Meox2	A	T	12: 37,108,936	M36L	probably benign	Het
Mgat5b	T	A	11: 116,985,029	L693Q	probably damaging	Het
Mup4	T	A	4: 59,958,124	E148V	possibly damaging	Het
Napb	T	C	2: 148,703,137	N162S	possibly damaging	Het
Nlgn2	T	C	11: 69,827,737	D339G	probably benign	Het
Nucks1	C	T	1: 131,928,102	R90C	possibly damaging	Het
Olfr1431	T	A	19: 12,210,154	V196E	possibly damaging	Het
Olfr740	T	C	14: 50,453,739	V229A	probably damaging	Het
Plekhd1	A	T	12: 80,692,949	D24V	probably damaging	Het
Prpf4b	C	T	13: 34,899,975	P909L	probably damaging	Het
Rasgrp1	T	A	2: 117,302,004	K116*	probably null	Het
Ror1	A	G	4: 100,411,936	T324A	possibly damaging	Het
Slc24a4	G	A	12: 102,264,370	G505R	probably damaging	Het
Slc8a1	A	G	17: 81,649,273	I112T	possibly damaging	Het
Smarcc2	A	G	10: 128,461,445	S69G	probably damaging	Het
Smc2	A	T	4: 52,458,447	E429D	probably damaging	Het
Sry	T	C	Y: 2,663,312	D116G	probably damaging	Het
Tcea3	T	A	4: 136,257,935	V154E	possibly damaging	Het
Tigd2	G	A	6: 59,211,220	W357*	probably null	Het
Tmem177	T	A	1: 119,910,689	T87S	probably benign	Het
Treh	A	T	9: 44,682,889	E144V	probably null	Het
Trpm6	T	A	19: 18,786,760	D243E	probably damaging	Het
Ttn	T	C	2: 76,778,050	D17843G	probably damaging	Het
Vars2	A	C	17: 35,659,473		probably null	Het
Vmn1r201	G	A	13: 22,475,360	W248*	probably null	Het
Yap1	T	C	9: 8,001,689	T99A	probably benign	Het
Zbtb8b	C	A	4: 129,433,000	C91F	probably damaging	Het
Zfp882	A	G	8: 71,914,654	T442A	possibly damaging	Het
Zxdc	G	T	6: 90,382,338	G651C	probably benign	Het

Other mutations in Comp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01596:Comp	APN	8	70378635	missense	probably damaging	1.00
IGL02110:Comp	APN	8	70373639	missense	probably benign	0.08
IGL02721:Comp	APN	8	70376081	missense	probably damaging	1.00
IGL02812:Comp	APN	8	70376687	missense	possibly damaging	0.75
IGL03023:Comp	APN	8	70378610	unclassified	probably benign
BB007:Comp	UTSW	8	70373853	missense	probably damaging	1.00
BB017:Comp	UTSW	8	70373853	missense	probably damaging	1.00
IGL03047:Comp	UTSW	8	70374909	missense	possibly damaging	0.65
R0217:Comp	UTSW	8	70378908	missense	probably damaging	1.00
R0503:Comp	UTSW	8	70375734	missense	possibly damaging	0.58
R0659:Comp	UTSW	8	70379101	missense	possibly damaging	0.84
R1490:Comp	UTSW	8	70373913	missense	possibly damaging	0.63
R1663:Comp	UTSW	8	70373600	missense	possibly damaging	0.93
R1666:Comp	UTSW	8	70378957	splice site	probably null
R1668:Comp	UTSW	8	70378957	splice site	probably null
R1789:Comp	UTSW	8	70377146	missense	probably benign	0.01
R2096:Comp	UTSW	8	70376063	missense	probably damaging	1.00
R2157:Comp	UTSW	8	70379570	nonsense	probably null
R3836:Comp	UTSW	8	70373859	missense	probably benign	0.26
R4630:Comp	UTSW	8	70374382	missense	possibly damaging	0.94
R4743:Comp	UTSW	8	70376061	missense	probably damaging	1.00
R4747:Comp	UTSW	8	70376702	missense	probably damaging	1.00
R5070:Comp	UTSW	8	70376495	missense	probably benign	0.25
R5083:Comp	UTSW	8	70381300	missense	probably damaging	1.00
R5917:Comp	UTSW	8	70376361	splice site	probably null
R6705:Comp	UTSW	8	70376737	missense	probably damaging	0.98
R6965:Comp	UTSW	8	70376514	missense	probably damaging	1.00
R7309:Comp	UTSW	8	70373678	splice site	probably null
R7402:Comp	UTSW	8	70377204	missense	probably benign	0.01
R7501:Comp	UTSW	8	70379409	missense	possibly damaging	0.82
R7541:Comp	UTSW	8	70381350	missense	probably damaging	1.00
R7568:Comp	UTSW	8	70373859	missense	probably benign	0.26
R7930:Comp	UTSW	8	70373853	missense	probably damaging	1.00
R8103:Comp	UTSW	8	70381286	missense	probably damaging	1.00
R8259:Comp	UTSW	8	70379054	missense	probably damaging	1.00
R8271:Comp	UTSW	8	70376460	missense	probably damaging	1.00
Z1177:Comp	UTSW	8	70377221	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GCCATGAGAAAGCAAACTGC -3'
(R):5'- AAGAAGGTCTGGTCCCTCTG -3'

Sequencing Primer
(F):5'- TCCGGCGTACGTGGACATTTC -3'
(R):5'- CCTCTGCTGGAAGCTAGATAACTAG -3'

Posted On

2016-06-06