Incidental Mutation 'R5028:Nlgn2'
ID391521
Institutional Source Beutler Lab
Gene Symbol Nlgn2
Ensembl Gene ENSMUSG00000051790
Gene Nameneuroligin 2
SynonymsNL2
MMRRC Submission 042619-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5028 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69823122-69837784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69827737 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 339 (D339G)
Ref Sequence ENSEMBL: ENSMUSP00000104274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056484] [ENSMUST00000108634]
Predicted Effect probably benign
Transcript: ENSMUST00000056484
AA Change: D339G

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000053097
Gene: ENSMUSG00000051790
AA Change: D339G

DomainStartEndE-ValueType
Pfam:COesterase 31 601 1.6e-199 PFAM
Pfam:Abhydrolase_3 180 372 4.8e-9 PFAM
low complexity region 630 652 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
low complexity region 702 712 N/A INTRINSIC
low complexity region 713 731 N/A INTRINSIC
low complexity region 782 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108634
AA Change: D339G

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104274
Gene: ENSMUSG00000051790
AA Change: D339G

DomainStartEndE-ValueType
Pfam:COesterase 30 601 2e-186 PFAM
Pfam:Abhydrolase_3 180 327 3.3e-9 PFAM
low complexity region 630 652 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
low complexity region 702 712 N/A INTRINSIC
low complexity region 713 731 N/A INTRINSIC
low complexity region 782 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139893
SMART Domains Protein: ENSMUSP00000120428
Gene: ENSMUSG00000051790

DomainStartEndE-ValueType
Pfam:COesterase 1 262 9.3e-120 PFAM
Pfam:Abhydrolase_3 104 250 2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140477
Meta Mutation Damage Score 0.1875 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional ready allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,274,012 S777C probably damaging Het
Ano5 T A 7: 51,537,710 probably null Het
Arhgap17 T A 7: 123,294,673 H508L probably benign Het
Arhgap29 T A 3: 122,010,060 probably null Het
Atp12a T C 14: 56,386,978 F961S probably damaging Het
B4galnt4 C A 7: 141,068,062 P497Q probably benign Het
Camsap1 A G 2: 25,944,556 S364P probably damaging Het
Ccdc150 C A 1: 54,263,477 D85E probably benign Het
Cdc45 A G 16: 18,795,180 Y291H probably benign Het
Comp A C 8: 70,376,640 N289T probably damaging Het
Cops3 T A 11: 59,818,030 probably benign Het
Crybg1 G A 10: 43,998,212 H967Y possibly damaging Het
Csmd1 A T 8: 15,989,090 F2423I probably damaging Het
Dact1 C A 12: 71,318,573 C709* probably null Het
Dcxr T G 11: 120,726,447 Q90P probably damaging Het
Ell A G 8: 70,590,699 Y494C probably damaging Het
Emilin2 T C 17: 71,274,732 E333G possibly damaging Het
Eml2 T C 7: 19,179,447 probably null Het
Fam186b T A 15: 99,280,801 M215L probably damaging Het
Gm17078 T A 14: 51,611,242 R13W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hspa14 A G 2: 3,498,169 F196S possibly damaging Het
Ier5 A G 1: 155,099,103 S110P possibly damaging Het
Kif1a T A 1: 93,054,327 I793F possibly damaging Het
Lrrc43 T C 5: 123,508,113 I643T probably damaging Het
Map3k19 A T 1: 127,823,232 L794Q probably benign Het
Meox2 A T 12: 37,108,936 M36L probably benign Het
Mgat5b T A 11: 116,985,029 L693Q probably damaging Het
Mup4 T A 4: 59,958,124 E148V possibly damaging Het
Napb T C 2: 148,703,137 N162S possibly damaging Het
Nucks1 C T 1: 131,928,102 R90C possibly damaging Het
Olfr1431 T A 19: 12,210,154 V196E possibly damaging Het
Olfr740 T C 14: 50,453,739 V229A probably damaging Het
Plekhd1 A T 12: 80,692,949 D24V probably damaging Het
Prpf4b C T 13: 34,899,975 P909L probably damaging Het
Rasgrp1 T A 2: 117,302,004 K116* probably null Het
Ror1 A G 4: 100,411,936 T324A possibly damaging Het
Slc24a4 G A 12: 102,264,370 G505R probably damaging Het
Slc8a1 A G 17: 81,649,273 I112T possibly damaging Het
Smarcc2 A G 10: 128,461,445 S69G probably damaging Het
Smc2 A T 4: 52,458,447 E429D probably damaging Het
Sry T C Y: 2,663,312 D116G probably damaging Het
Tcea3 T A 4: 136,257,935 V154E possibly damaging Het
Tigd2 G A 6: 59,211,220 W357* probably null Het
Tmem177 T A 1: 119,910,689 T87S probably benign Het
Treh A T 9: 44,682,889 E144V probably null Het
Trpm6 T A 19: 18,786,760 D243E probably damaging Het
Ttn T C 2: 76,778,050 D17843G probably damaging Het
Vars2 A C 17: 35,659,473 probably null Het
Vmn1r201 G A 13: 22,475,360 W248* probably null Het
Yap1 T C 9: 8,001,689 T99A probably benign Het
Zbtb8b C A 4: 129,433,000 C91F probably damaging Het
Zfp882 A G 8: 71,914,654 T442A possibly damaging Het
Zxdc G T 6: 90,382,338 G651C probably benign Het
Other mutations in Nlgn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Nlgn2 APN 11 69825849 missense possibly damaging 0.78
IGL02649:Nlgn2 APN 11 69825802 missense probably benign 0.04
IGL02887:Nlgn2 APN 11 69827254 missense probably benign 0.24
IGL02904:Nlgn2 APN 11 69825840 missense possibly damaging 0.91
P0040:Nlgn2 UTSW 11 69825730 missense probably benign 0.01
R0800:Nlgn2 UTSW 11 69825997 missense possibly damaging 0.92
R1901:Nlgn2 UTSW 11 69825900 missense probably damaging 1.00
R1960:Nlgn2 UTSW 11 69827310 missense probably damaging 1.00
R1997:Nlgn2 UTSW 11 69828050 missense probably damaging 1.00
R2020:Nlgn2 UTSW 11 69828441 missense probably damaging 1.00
R2426:Nlgn2 UTSW 11 69827086 missense probably damaging 1.00
R3768:Nlgn2 UTSW 11 69828404 missense possibly damaging 0.95
R4584:Nlgn2 UTSW 11 69834278 missense possibly damaging 0.48
R4609:Nlgn2 UTSW 11 69834086 missense probably damaging 0.99
R5141:Nlgn2 UTSW 11 69825390 missense probably damaging 1.00
R5149:Nlgn2 UTSW 11 69825390 missense probably damaging 1.00
R5150:Nlgn2 UTSW 11 69825390 missense probably damaging 1.00
R5458:Nlgn2 UTSW 11 69827900 missense possibly damaging 0.87
R5930:Nlgn2 UTSW 11 69834149 missense probably damaging 1.00
R6823:Nlgn2 UTSW 11 69825924 missense probably damaging 1.00
R7096:Nlgn2 UTSW 11 69825690 missense probably damaging 1.00
R7310:Nlgn2 UTSW 11 69830583 missense possibly damaging 0.64
R7318:Nlgn2 UTSW 11 69825969 missense probably damaging 1.00
R7643:Nlgn2 UTSW 11 69827885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAAAGCATTCTGTGAAACCCTG -3'
(R):5'- ACTGTTCCAGAAGGCCATTG -3'

Sequencing Primer
(F):5'- ATGTGGTATGGTGACCTCCACATAAG -3'
(R):5'- GCCATTGCTCAAAGTGGTAC -3'
Posted On2016-06-06