Incidental Mutation 'R5028:Meox2'
ID391524
Institutional Source Beutler Lab
Gene Symbol Meox2
Ensembl Gene ENSMUSG00000036144
Gene Namemesenchyme homeobox 2
SynonymsGax, Mox2, Mox-2
MMRRC Submission 042619-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.822) question?
Stock #R5028 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location37108540-37179534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37108936 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 36 (M36L)
Ref Sequence ENSEMBL: ENSMUSP00000043587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041183]
Predicted Effect probably benign
Transcript: ENSMUST00000041183
AA Change: M36L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043587
Gene: ENSMUSG00000036144
AA Change: M36L

DomainStartEndE-ValueType
low complexity region 63 85 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
HOX 186 248 1.56e-28 SMART
low complexity region 289 300 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222665
Meta Mutation Damage Score 0.0798 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of non-clustered, diverged, antennapedia-like homeobox-containing genes. The encoded protein may play a role in the regulation of vertebrate limb myogenesis. Mutations in the related mouse protein may be associated with craniofacial and/or skeletal abnormalities, in addition to neurovascular dysfunction observed in Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Several mutations that inactivate the gene result in mild defects of rib and vertebrae development. Inactivation in conjunction with a null mutation in a related homeobox gene results in more severe defects stemming from impaired somite formation, patterning, and differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,274,012 S777C probably damaging Het
Ano5 T A 7: 51,537,710 probably null Het
Arhgap17 T A 7: 123,294,673 H508L probably benign Het
Arhgap29 T A 3: 122,010,060 probably null Het
Atp12a T C 14: 56,386,978 F961S probably damaging Het
B4galnt4 C A 7: 141,068,062 P497Q probably benign Het
Camsap1 A G 2: 25,944,556 S364P probably damaging Het
Ccdc150 C A 1: 54,263,477 D85E probably benign Het
Cdc45 A G 16: 18,795,180 Y291H probably benign Het
Comp A C 8: 70,376,640 N289T probably damaging Het
Cops3 T A 11: 59,818,030 probably benign Het
Crybg1 G A 10: 43,998,212 H967Y possibly damaging Het
Csmd1 A T 8: 15,989,090 F2423I probably damaging Het
Dact1 C A 12: 71,318,573 C709* probably null Het
Dcxr T G 11: 120,726,447 Q90P probably damaging Het
Ell A G 8: 70,590,699 Y494C probably damaging Het
Emilin2 T C 17: 71,274,732 E333G possibly damaging Het
Eml2 T C 7: 19,179,447 probably null Het
Fam186b T A 15: 99,280,801 M215L probably damaging Het
Gm17078 T A 14: 51,611,242 R13W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hspa14 A G 2: 3,498,169 F196S possibly damaging Het
Ier5 A G 1: 155,099,103 S110P possibly damaging Het
Kif1a T A 1: 93,054,327 I793F possibly damaging Het
Lrrc43 T C 5: 123,508,113 I643T probably damaging Het
Map3k19 A T 1: 127,823,232 L794Q probably benign Het
Mgat5b T A 11: 116,985,029 L693Q probably damaging Het
Mup4 T A 4: 59,958,124 E148V possibly damaging Het
Napb T C 2: 148,703,137 N162S possibly damaging Het
Nlgn2 T C 11: 69,827,737 D339G probably benign Het
Nucks1 C T 1: 131,928,102 R90C possibly damaging Het
Olfr1431 T A 19: 12,210,154 V196E possibly damaging Het
Olfr740 T C 14: 50,453,739 V229A probably damaging Het
Plekhd1 A T 12: 80,692,949 D24V probably damaging Het
Prpf4b C T 13: 34,899,975 P909L probably damaging Het
Rasgrp1 T A 2: 117,302,004 K116* probably null Het
Ror1 A G 4: 100,411,936 T324A possibly damaging Het
Slc24a4 G A 12: 102,264,370 G505R probably damaging Het
Slc8a1 A G 17: 81,649,273 I112T possibly damaging Het
Smarcc2 A G 10: 128,461,445 S69G probably damaging Het
Smc2 A T 4: 52,458,447 E429D probably damaging Het
Sry T C Y: 2,663,312 D116G probably damaging Het
Tcea3 T A 4: 136,257,935 V154E possibly damaging Het
Tigd2 G A 6: 59,211,220 W357* probably null Het
Tmem177 T A 1: 119,910,689 T87S probably benign Het
Treh A T 9: 44,682,889 E144V probably null Het
Trpm6 T A 19: 18,786,760 D243E probably damaging Het
Ttn T C 2: 76,778,050 D17843G probably damaging Het
Vars2 A C 17: 35,659,473 probably null Het
Vmn1r201 G A 13: 22,475,360 W248* probably null Het
Yap1 T C 9: 8,001,689 T99A probably benign Het
Zbtb8b C A 4: 129,433,000 C91F probably damaging Het
Zfp882 A G 8: 71,914,654 T442A possibly damaging Het
Zxdc G T 6: 90,382,338 G651C probably benign Het
Other mutations in Meox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02675:Meox2 APN 12 37178334 missense probably damaging 0.99
IGL02935:Meox2 APN 12 37109105 missense probably damaging 0.99
R1173:Meox2 UTSW 12 37109152 missense possibly damaging 0.95
R1306:Meox2 UTSW 12 37109031 small deletion probably benign
R1705:Meox2 UTSW 12 37167494 splice site probably benign
R2104:Meox2 UTSW 12 37167477 missense probably damaging 1.00
R6118:Meox2 UTSW 12 37109031 small deletion probably benign
R6414:Meox2 UTSW 12 37108831 start codon destroyed probably benign 0.33
R7016:Meox2 UTSW 12 37109224 missense probably benign 0.07
R7373:Meox2 UTSW 12 37108798 start gained probably benign
X0023:Meox2 UTSW 12 37109145 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGCTCAAATGCAAACGCGC -3'
(R):5'- AGTTGCTTTGCAGAGCCTG -3'

Sequencing Primer
(F):5'- TTTCCAGTGAAAAGTGACAGCGC -3'
(R):5'- GCCTGGTGCTGCTGCTG -3'
Posted On2016-06-06