Incidental Mutation 'R5028:Slc24a4'
ID391528
Institutional Source Beutler Lab
Gene Symbol Slc24a4
Ensembl Gene ENSMUSG00000041771
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 4
SynonymsNCKX4, A930002M03Rik
MMRRC Submission 042619-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5028 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location102128733-102267091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102264370 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 505 (G505R)
Ref Sequence ENSEMBL: ENSMUSP00000124513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079020] [ENSMUST00000159329]
Predicted Effect probably damaging
Transcript: ENSMUST00000079020
AA Change: G507R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078030
Gene: ENSMUSG00000041771
AA Change: G507R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Na_Ca_ex 86 229 2.4e-31 PFAM
low complexity region 367 388 N/A INTRINSIC
Pfam:Na_Ca_ex 435 587 2.4e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159329
AA Change: G505R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124513
Gene: ENSMUSG00000041771
AA Change: G505R

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Na_Ca_ex 113 245 1e-32 PFAM
low complexity region 365 386 N/A INTRINSIC
Pfam:Na_Ca_ex 443 562 1.4e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161325
AA Change: G504R
SMART Domains Protein: ENSMUSP00000125012
Gene: ENSMUSG00000041771
AA Change: G504R

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Na_Ca_ex 103 246 1.3e-31 PFAM
low complexity region 365 386 N/A INTRINSIC
Pfam:Na_Ca_ex 433 585 1.3e-30 PFAM
Meta Mutation Damage Score 0.8950 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium-dependent sodium/calcium exchanger protein family. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired olfactory response and reduced weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,274,012 S777C probably damaging Het
Ano5 T A 7: 51,537,710 probably null Het
Arhgap17 T A 7: 123,294,673 H508L probably benign Het
Arhgap29 T A 3: 122,010,060 probably null Het
Atp12a T C 14: 56,386,978 F961S probably damaging Het
B4galnt4 C A 7: 141,068,062 P497Q probably benign Het
Camsap1 A G 2: 25,944,556 S364P probably damaging Het
Ccdc150 C A 1: 54,263,477 D85E probably benign Het
Cdc45 A G 16: 18,795,180 Y291H probably benign Het
Comp A C 8: 70,376,640 N289T probably damaging Het
Cops3 T A 11: 59,818,030 probably benign Het
Crybg1 G A 10: 43,998,212 H967Y possibly damaging Het
Csmd1 A T 8: 15,989,090 F2423I probably damaging Het
Dact1 C A 12: 71,318,573 C709* probably null Het
Dcxr T G 11: 120,726,447 Q90P probably damaging Het
Ell A G 8: 70,590,699 Y494C probably damaging Het
Emilin2 T C 17: 71,274,732 E333G possibly damaging Het
Eml2 T C 7: 19,179,447 probably null Het
Fam186b T A 15: 99,280,801 M215L probably damaging Het
Gm17078 T A 14: 51,611,242 R13W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hspa14 A G 2: 3,498,169 F196S possibly damaging Het
Ier5 A G 1: 155,099,103 S110P possibly damaging Het
Kif1a T A 1: 93,054,327 I793F possibly damaging Het
Lrrc43 T C 5: 123,508,113 I643T probably damaging Het
Map3k19 A T 1: 127,823,232 L794Q probably benign Het
Meox2 A T 12: 37,108,936 M36L probably benign Het
Mgat5b T A 11: 116,985,029 L693Q probably damaging Het
Mup4 T A 4: 59,958,124 E148V possibly damaging Het
Napb T C 2: 148,703,137 N162S possibly damaging Het
Nlgn2 T C 11: 69,827,737 D339G probably benign Het
Nucks1 C T 1: 131,928,102 R90C possibly damaging Het
Olfr1431 T A 19: 12,210,154 V196E possibly damaging Het
Olfr740 T C 14: 50,453,739 V229A probably damaging Het
Plekhd1 A T 12: 80,692,949 D24V probably damaging Het
Prpf4b C T 13: 34,899,975 P909L probably damaging Het
Rasgrp1 T A 2: 117,302,004 K116* probably null Het
Ror1 A G 4: 100,411,936 T324A possibly damaging Het
Slc8a1 A G 17: 81,649,273 I112T possibly damaging Het
Smarcc2 A G 10: 128,461,445 S69G probably damaging Het
Smc2 A T 4: 52,458,447 E429D probably damaging Het
Sry T C Y: 2,663,312 D116G probably damaging Het
Tcea3 T A 4: 136,257,935 V154E possibly damaging Het
Tigd2 G A 6: 59,211,220 W357* probably null Het
Tmem177 T A 1: 119,910,689 T87S probably benign Het
Treh A T 9: 44,682,889 E144V probably null Het
Trpm6 T A 19: 18,786,760 D243E probably damaging Het
Ttn T C 2: 76,778,050 D17843G probably damaging Het
Vars2 A C 17: 35,659,473 probably null Het
Vmn1r201 G A 13: 22,475,360 W248* probably null Het
Yap1 T C 9: 8,001,689 T99A probably benign Het
Zbtb8b C A 4: 129,433,000 C91F probably damaging Het
Zfp882 A G 8: 71,914,654 T442A possibly damaging Het
Zxdc G T 6: 90,382,338 G651C probably benign Het
Other mutations in Slc24a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Slc24a4 APN 12 102223635 missense probably benign 0.09
IGL01724:Slc24a4 APN 12 102218960 missense possibly damaging 0.78
IGL01767:Slc24a4 APN 12 102223687 splice site probably benign
IGL01814:Slc24a4 APN 12 102254618 missense probably benign 0.00
IGL02047:Slc24a4 APN 12 102254623 missense probably damaging 1.00
IGL02449:Slc24a4 APN 12 102227082 missense probably benign 0.00
IGL02632:Slc24a4 APN 12 102234682 missense probably benign 0.15
IGL03251:Slc24a4 APN 12 102222825 missense probably damaging 0.98
spindly UTSW 12 102264944 critical splice donor site probably null
R0207:Slc24a4 UTSW 12 102228951 critical splice donor site probably null
R0284:Slc24a4 UTSW 12 102260481 missense probably damaging 1.00
R0506:Slc24a4 UTSW 12 102131623 critical splice donor site probably null
R1903:Slc24a4 UTSW 12 102131617 missense probably benign 0.00
R2004:Slc24a4 UTSW 12 102213907 missense probably damaging 1.00
R2126:Slc24a4 UTSW 12 102222759 missense probably damaging 1.00
R2518:Slc24a4 UTSW 12 102222051 missense probably benign 0.02
R3498:Slc24a4 UTSW 12 102234692 missense probably benign
R3620:Slc24a4 UTSW 12 102218963 missense probably damaging 1.00
R3621:Slc24a4 UTSW 12 102218963 missense probably damaging 1.00
R4917:Slc24a4 UTSW 12 102264944 critical splice donor site probably null
R5886:Slc24a4 UTSW 12 102260415 missense probably damaging 1.00
R5914:Slc24a4 UTSW 12 102234790 missense probably damaging 1.00
R6257:Slc24a4 UTSW 12 102254510 missense probably benign 0.00
R6305:Slc24a4 UTSW 12 102222101 missense possibly damaging 0.84
R6313:Slc24a4 UTSW 12 102254510 missense probably benign 0.00
R6734:Slc24a4 UTSW 12 102219000 missense probably damaging 1.00
R7378:Slc24a4 UTSW 12 102239176 missense probably benign 0.06
R7419:Slc24a4 UTSW 12 102227091 critical splice donor site probably null
R7529:Slc24a4 UTSW 12 102264448 missense probably benign 0.01
R7715:Slc24a4 UTSW 12 102218960 missense possibly damaging 0.89
R7781:Slc24a4 UTSW 12 102234853 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGACATCCACGTACAGATCC -3'
(R):5'- AAAGGGTAGCACATCTCCCC -3'

Sequencing Primer
(F):5'- CCTTTAGGTCTCATGAAAAGAAGG -3'
(R):5'- TCCCCAGAACTCCAGGCTG -3'
Posted On2016-06-06