Mutagenetix > Incidental Mutations

Incidental Mutation 'R5028:Olfr740'

391531

Institutional Source

Beutler Lab

Gene Symbol

Olfr740

Ensembl Gene

ENSMUSG00000095917

Gene Name

olfactory receptor 740

Synonyms

MOR106-4, GA_x6K02T2PMLR-6167145-6168080

MMRRC Submission

042619-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R5028 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50445545-50456933 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 50453739 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 229 (V229A)

Ref Sequence

ENSEMBL: ENSMUSP00000148916 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089838] [ENSMUST00000214792]

Predicted Effect

probably damaging
Transcript: ENSMUST00000089838
AA Change: V229A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000087276
Gene: ENSMUSG00000095917
AA Change: V229A

Domain	Start	End	E-Value	Type
Pfam:7tm_4	35	311	2.3e-56	PFAM
Pfam:7tm_1	45	294	1.6e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214792
AA Change: V229A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Meta Mutation Damage Score

0.39

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

97% (62/64)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	T	A	2: 69,274,012	S777C	probably damaging	Het
Ano5	T	A	7: 51,537,710		probably null	Het
Arhgap17	T	A	7: 123,294,673	H508L	probably benign	Het
Arhgap29	T	A	3: 122,010,060		probably null	Het
Atp12a	T	C	14: 56,386,978	F961S	probably damaging	Het
B4galnt4	C	A	7: 141,068,062	P497Q	probably benign	Het
Camsap1	A	G	2: 25,944,556	S364P	probably damaging	Het
Ccdc150	C	A	1: 54,263,477	D85E	probably benign	Het
Cdc45	A	G	16: 18,795,180	Y291H	probably benign	Het
Comp	A	C	8: 70,376,640	N289T	probably damaging	Het
Cops3	T	A	11: 59,818,030		probably benign	Het
Crybg1	G	A	10: 43,998,212	H967Y	possibly damaging	Het
Csmd1	A	T	8: 15,989,090	F2423I	probably damaging	Het
Dact1	C	A	12: 71,318,573	C709*	probably null	Het
Dcxr	T	G	11: 120,726,447	Q90P	probably damaging	Het
Ell	A	G	8: 70,590,699	Y494C	probably damaging	Het
Emilin2	T	C	17: 71,274,732	E333G	possibly damaging	Het
Eml2	T	C	7: 19,179,447		probably null	Het
Fam186b	T	A	15: 99,280,801	M215L	probably damaging	Het
Gm17078	T	A	14: 51,611,242	R13W	probably null	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Hspa14	A	G	2: 3,498,169	F196S	possibly damaging	Het
Ier5	A	G	1: 155,099,103	S110P	possibly damaging	Het
Kif1a	T	A	1: 93,054,327	I793F	possibly damaging	Het
Lrrc43	T	C	5: 123,508,113	I643T	probably damaging	Het
Map3k19	A	T	1: 127,823,232	L794Q	probably benign	Het
Meox2	A	T	12: 37,108,936	M36L	probably benign	Het
Mgat5b	T	A	11: 116,985,029	L693Q	probably damaging	Het
Mup4	T	A	4: 59,958,124	E148V	possibly damaging	Het
Napb	T	C	2: 148,703,137	N162S	possibly damaging	Het
Nlgn2	T	C	11: 69,827,737	D339G	probably benign	Het
Nucks1	C	T	1: 131,928,102	R90C	possibly damaging	Het
Olfr1431	T	A	19: 12,210,154	V196E	possibly damaging	Het
Plekhd1	A	T	12: 80,692,949	D24V	probably damaging	Het
Prpf4b	C	T	13: 34,899,975	P909L	probably damaging	Het
Rasgrp1	T	A	2: 117,302,004	K116*	probably null	Het
Ror1	A	G	4: 100,411,936	T324A	possibly damaging	Het
Slc24a4	G	A	12: 102,264,370	G505R	probably damaging	Het
Slc8a1	A	G	17: 81,649,273	I112T	possibly damaging	Het
Smarcc2	A	G	10: 128,461,445	S69G	probably damaging	Het
Smc2	A	T	4: 52,458,447	E429D	probably damaging	Het
Sry	T	C	Y: 2,663,312	D116G	probably damaging	Het
Tcea3	T	A	4: 136,257,935	V154E	possibly damaging	Het
Tigd2	G	A	6: 59,211,220	W357*	probably null	Het
Tmem177	T	A	1: 119,910,689	T87S	probably benign	Het
Treh	A	T	9: 44,682,889	E144V	probably null	Het
Trpm6	T	A	19: 18,786,760	D243E	probably damaging	Het
Ttn	T	C	2: 76,778,050	D17843G	probably damaging	Het
Vars2	A	C	17: 35,659,473		probably null	Het
Vmn1r201	G	A	13: 22,475,360	W248*	probably null	Het
Yap1	T	C	9: 8,001,689	T99A	probably benign	Het
Zbtb8b	C	A	4: 129,433,000	C91F	probably damaging	Het
Zfp882	A	G	8: 71,914,654	T442A	possibly damaging	Het
Zxdc	G	T	6: 90,382,338	G651C	probably benign	Het

Other mutations in Olfr740

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01663:Olfr740	APN	14	50453150	missense	probably benign	0.04
IGL02117:Olfr740	APN	14	50453942	missense	possibly damaging	0.91
IGL02663:Olfr740	APN	14	50453852	missense	probably benign	0.02
IGL02858:Olfr740	APN	14	50453050	utr 5 prime	probably benign
IGL02955:Olfr740	APN	14	50453985	missense	probably damaging	0.99
IGL03210:Olfr740	APN	14	50453983	missense	probably benign	0.10
IGL03249:Olfr740	APN	14	50453211	missense	probably damaging	0.98
R0946:Olfr740	UTSW	14	50453673	missense	probably benign	0.13
R1449:Olfr740	UTSW	14	50453921	missense	probably damaging	1.00
R1465:Olfr740	UTSW	14	50453177	missense	possibly damaging	0.91
R1465:Olfr740	UTSW	14	50453177	missense	possibly damaging	0.91
R1513:Olfr740	UTSW	14	50453681	missense	probably benign	0.00
R1908:Olfr740	UTSW	14	50453838	missense	probably damaging	0.99
R2422:Olfr740	UTSW	14	50453436	missense	probably damaging	1.00
R3406:Olfr740	UTSW	14	50453196	missense	probably benign	0.14
R4184:Olfr740	UTSW	14	50453370	missense	probably damaging	1.00
R4795:Olfr740	UTSW	14	50453417	missense	probably damaging	0.96
R5436:Olfr740	UTSW	14	50453727	missense	probably damaging	1.00
R6057:Olfr740	UTSW	14	50453744	nonsense	probably null
R6455:Olfr740	UTSW	14	50453585	missense	possibly damaging	0.92
R6903:Olfr740	UTSW	14	50453955	missense	possibly damaging	0.93
R6998:Olfr740	UTSW	14	50453433	missense	probably benign	0.29
X0066:Olfr740	UTSW	14	50453658	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGTGGGTCCAGAATTATAGACC -3'
(R):5'- CTGCAGGGCATGTTTCATATCC -3'

Sequencing Primer
(F):5'- GGTCCAGAATTATAGACCACTTCCTG -3'
(R):5'- TCACAGGATTAATGAGTGGAGTAACC -3'

Posted On

2016-06-06