Incidental Mutation 'R5028:Olfr740'
ID391531
Institutional Source Beutler Lab
Gene Symbol Olfr740
Ensembl Gene ENSMUSG00000095917
Gene Nameolfactory receptor 740
SynonymsMOR106-4, GA_x6K02T2PMLR-6167145-6168080
MMRRC Submission 042619-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5028 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50445545-50456933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50453739 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 229 (V229A)
Ref Sequence ENSEMBL: ENSMUSP00000148916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089838] [ENSMUST00000214792]
Predicted Effect probably damaging
Transcript: ENSMUST00000089838
AA Change: V229A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087276
Gene: ENSMUSG00000095917
AA Change: V229A

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.3e-56 PFAM
Pfam:7tm_1 45 294 1.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214792
AA Change: V229A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.39 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,274,012 S777C probably damaging Het
Ano5 T A 7: 51,537,710 probably null Het
Arhgap17 T A 7: 123,294,673 H508L probably benign Het
Arhgap29 T A 3: 122,010,060 probably null Het
Atp12a T C 14: 56,386,978 F961S probably damaging Het
B4galnt4 C A 7: 141,068,062 P497Q probably benign Het
Camsap1 A G 2: 25,944,556 S364P probably damaging Het
Ccdc150 C A 1: 54,263,477 D85E probably benign Het
Cdc45 A G 16: 18,795,180 Y291H probably benign Het
Comp A C 8: 70,376,640 N289T probably damaging Het
Cops3 T A 11: 59,818,030 probably benign Het
Crybg1 G A 10: 43,998,212 H967Y possibly damaging Het
Csmd1 A T 8: 15,989,090 F2423I probably damaging Het
Dact1 C A 12: 71,318,573 C709* probably null Het
Dcxr T G 11: 120,726,447 Q90P probably damaging Het
Ell A G 8: 70,590,699 Y494C probably damaging Het
Emilin2 T C 17: 71,274,732 E333G possibly damaging Het
Eml2 T C 7: 19,179,447 probably null Het
Fam186b T A 15: 99,280,801 M215L probably damaging Het
Gm17078 T A 14: 51,611,242 R13W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hspa14 A G 2: 3,498,169 F196S possibly damaging Het
Ier5 A G 1: 155,099,103 S110P possibly damaging Het
Kif1a T A 1: 93,054,327 I793F possibly damaging Het
Lrrc43 T C 5: 123,508,113 I643T probably damaging Het
Map3k19 A T 1: 127,823,232 L794Q probably benign Het
Meox2 A T 12: 37,108,936 M36L probably benign Het
Mgat5b T A 11: 116,985,029 L693Q probably damaging Het
Mup4 T A 4: 59,958,124 E148V possibly damaging Het
Napb T C 2: 148,703,137 N162S possibly damaging Het
Nlgn2 T C 11: 69,827,737 D339G probably benign Het
Nucks1 C T 1: 131,928,102 R90C possibly damaging Het
Olfr1431 T A 19: 12,210,154 V196E possibly damaging Het
Plekhd1 A T 12: 80,692,949 D24V probably damaging Het
Prpf4b C T 13: 34,899,975 P909L probably damaging Het
Rasgrp1 T A 2: 117,302,004 K116* probably null Het
Ror1 A G 4: 100,411,936 T324A possibly damaging Het
Slc24a4 G A 12: 102,264,370 G505R probably damaging Het
Slc8a1 A G 17: 81,649,273 I112T possibly damaging Het
Smarcc2 A G 10: 128,461,445 S69G probably damaging Het
Smc2 A T 4: 52,458,447 E429D probably damaging Het
Sry T C Y: 2,663,312 D116G probably damaging Het
Tcea3 T A 4: 136,257,935 V154E possibly damaging Het
Tigd2 G A 6: 59,211,220 W357* probably null Het
Tmem177 T A 1: 119,910,689 T87S probably benign Het
Treh A T 9: 44,682,889 E144V probably null Het
Trpm6 T A 19: 18,786,760 D243E probably damaging Het
Ttn T C 2: 76,778,050 D17843G probably damaging Het
Vars2 A C 17: 35,659,473 probably null Het
Vmn1r201 G A 13: 22,475,360 W248* probably null Het
Yap1 T C 9: 8,001,689 T99A probably benign Het
Zbtb8b C A 4: 129,433,000 C91F probably damaging Het
Zfp882 A G 8: 71,914,654 T442A possibly damaging Het
Zxdc G T 6: 90,382,338 G651C probably benign Het
Other mutations in Olfr740
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Olfr740 APN 14 50453150 missense probably benign 0.04
IGL02117:Olfr740 APN 14 50453942 missense possibly damaging 0.91
IGL02663:Olfr740 APN 14 50453852 missense probably benign 0.02
IGL02858:Olfr740 APN 14 50453050 utr 5 prime probably benign
IGL02955:Olfr740 APN 14 50453985 missense probably damaging 0.99
IGL03210:Olfr740 APN 14 50453983 missense probably benign 0.10
IGL03249:Olfr740 APN 14 50453211 missense probably damaging 0.98
R0946:Olfr740 UTSW 14 50453673 missense probably benign 0.13
R1449:Olfr740 UTSW 14 50453921 missense probably damaging 1.00
R1465:Olfr740 UTSW 14 50453177 missense possibly damaging 0.91
R1465:Olfr740 UTSW 14 50453177 missense possibly damaging 0.91
R1513:Olfr740 UTSW 14 50453681 missense probably benign 0.00
R1908:Olfr740 UTSW 14 50453838 missense probably damaging 0.99
R2422:Olfr740 UTSW 14 50453436 missense probably damaging 1.00
R3406:Olfr740 UTSW 14 50453196 missense probably benign 0.14
R4184:Olfr740 UTSW 14 50453370 missense probably damaging 1.00
R4795:Olfr740 UTSW 14 50453417 missense probably damaging 0.96
R5436:Olfr740 UTSW 14 50453727 missense probably damaging 1.00
R6057:Olfr740 UTSW 14 50453744 nonsense probably null
R6455:Olfr740 UTSW 14 50453585 missense possibly damaging 0.92
R6903:Olfr740 UTSW 14 50453955 missense possibly damaging 0.93
R6998:Olfr740 UTSW 14 50453433 missense probably benign 0.29
X0066:Olfr740 UTSW 14 50453658 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTGGGTCCAGAATTATAGACC -3'
(R):5'- CTGCAGGGCATGTTTCATATCC -3'

Sequencing Primer
(F):5'- GGTCCAGAATTATAGACCACTTCCTG -3'
(R):5'- TCACAGGATTAATGAGTGGAGTAACC -3'
Posted On2016-06-06