Incidental Mutation 'R5028:Cdc45'
ID391535
Institutional Source Beutler Lab
Gene Symbol Cdc45
Ensembl Gene ENSMUSG00000000028
Gene Namecell division cycle 45
SynonymsCdc45l
MMRRC Submission 042619-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5028 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18780447-18811987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18795180 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 291 (Y291H)
Ref Sequence ENSEMBL: ENSMUSP00000000028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000028] [ENSMUST00000096990]
Predicted Effect probably benign
Transcript: ENSMUST00000000028
AA Change: Y291H

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000000028
Gene: ENSMUSG00000000028
AA Change: Y291H

DomainStartEndE-ValueType
Pfam:CDC45 19 564 1.6e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096990
AA Change: Y245H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000094753
Gene: ENSMUSG00000000028
AA Change: Y245H

DomainStartEndE-ValueType
Pfam:CDC45 18 74 7.9e-24 PFAM
Pfam:CDC45 73 520 4.5e-138 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its strong similarity with Saccharomyces cerevisiae Cdc45, an essential protein required to the initiation of DNA replication. Cdc45 is a member of the highly conserved multiprotein complex including Cdc6/Cdc18, the minichromosome maintenance proteins (MCMs) and DNA polymerase, which is important for early steps of DNA replication in eukaryotes. This protein has been shown to interact with MCM7 and DNA polymerase alpha. Studies of the similar gene in Xenopus suggested that this protein play a pivotal role in the loading of DNA polymerase alpha onto chromatin. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant embryos do not develop after implantation, resulting in embryonic lethality between E4.5-E5.5. Heterozygous animals appear normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,274,012 S777C probably damaging Het
Ano5 T A 7: 51,537,710 probably null Het
Arhgap17 T A 7: 123,294,673 H508L probably benign Het
Arhgap29 T A 3: 122,010,060 probably null Het
Atp12a T C 14: 56,386,978 F961S probably damaging Het
B4galnt4 C A 7: 141,068,062 P497Q probably benign Het
Camsap1 A G 2: 25,944,556 S364P probably damaging Het
Ccdc150 C A 1: 54,263,477 D85E probably benign Het
Comp A C 8: 70,376,640 N289T probably damaging Het
Cops3 T A 11: 59,818,030 probably benign Het
Crybg1 G A 10: 43,998,212 H967Y possibly damaging Het
Csmd1 A T 8: 15,989,090 F2423I probably damaging Het
Dact1 C A 12: 71,318,573 C709* probably null Het
Dcxr T G 11: 120,726,447 Q90P probably damaging Het
Ell A G 8: 70,590,699 Y494C probably damaging Het
Emilin2 T C 17: 71,274,732 E333G possibly damaging Het
Eml2 T C 7: 19,179,447 probably null Het
Fam186b T A 15: 99,280,801 M215L probably damaging Het
Gm17078 T A 14: 51,611,242 R13W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hspa14 A G 2: 3,498,169 F196S possibly damaging Het
Ier5 A G 1: 155,099,103 S110P possibly damaging Het
Kif1a T A 1: 93,054,327 I793F possibly damaging Het
Lrrc43 T C 5: 123,508,113 I643T probably damaging Het
Map3k19 A T 1: 127,823,232 L794Q probably benign Het
Meox2 A T 12: 37,108,936 M36L probably benign Het
Mgat5b T A 11: 116,985,029 L693Q probably damaging Het
Mup4 T A 4: 59,958,124 E148V possibly damaging Het
Napb T C 2: 148,703,137 N162S possibly damaging Het
Nlgn2 T C 11: 69,827,737 D339G probably benign Het
Nucks1 C T 1: 131,928,102 R90C possibly damaging Het
Olfr1431 T A 19: 12,210,154 V196E possibly damaging Het
Olfr740 T C 14: 50,453,739 V229A probably damaging Het
Plekhd1 A T 12: 80,692,949 D24V probably damaging Het
Prpf4b C T 13: 34,899,975 P909L probably damaging Het
Rasgrp1 T A 2: 117,302,004 K116* probably null Het
Ror1 A G 4: 100,411,936 T324A possibly damaging Het
Slc24a4 G A 12: 102,264,370 G505R probably damaging Het
Slc8a1 A G 17: 81,649,273 I112T possibly damaging Het
Smarcc2 A G 10: 128,461,445 S69G probably damaging Het
Smc2 A T 4: 52,458,447 E429D probably damaging Het
Sry T C Y: 2,663,312 D116G probably damaging Het
Tcea3 T A 4: 136,257,935 V154E possibly damaging Het
Tigd2 G A 6: 59,211,220 W357* probably null Het
Tmem177 T A 1: 119,910,689 T87S probably benign Het
Treh A T 9: 44,682,889 E144V probably null Het
Trpm6 T A 19: 18,786,760 D243E probably damaging Het
Ttn T C 2: 76,778,050 D17843G probably damaging Het
Vars2 A C 17: 35,659,473 probably null Het
Vmn1r201 G A 13: 22,475,360 W248* probably null Het
Yap1 T C 9: 8,001,689 T99A probably benign Het
Zbtb8b C A 4: 129,433,000 C91F probably damaging Het
Zfp882 A G 8: 71,914,654 T442A possibly damaging Het
Zxdc G T 6: 90,382,338 G651C probably benign Het
Other mutations in Cdc45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Cdc45 APN 16 18811561 missense probably damaging 1.00
IGL01677:Cdc45 APN 16 18787000 missense probably benign 0.02
IGL02079:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02080:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02105:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02106:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02237:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02238:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02239:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02371:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02441:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02442:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02465:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02466:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02468:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02469:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02470:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02471:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02472:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02473:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02489:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02490:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02491:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02492:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02511:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02558:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02559:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02560:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02561:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02562:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02566:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02567:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02576:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02583:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02589:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02626:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02627:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02628:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02629:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02687:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02688:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02689:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02720:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02724:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02731:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02738:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02991:Cdc45 UTSW 16 18798729 missense probably benign 0.06
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0458:Cdc45 UTSW 16 18781972 splice site probably benign
R1398:Cdc45 UTSW 16 18781971 splice site probably benign
R1413:Cdc45 UTSW 16 18808741 missense possibly damaging 0.63
R1792:Cdc45 UTSW 16 18807340 missense probably benign 0.01
R2919:Cdc45 UTSW 16 18808793 missense probably benign 0.00
R3956:Cdc45 UTSW 16 18805430 missense probably benign 0.00
R4079:Cdc45 UTSW 16 18811360 missense probably damaging 1.00
R4825:Cdc45 UTSW 16 18784863 missense probably damaging 0.98
R5214:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5215:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5309:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5311:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5312:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5352:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5353:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5354:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5355:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5356:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5424:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5426:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5655:Cdc45 UTSW 16 18807279 critical splice donor site probably null
R6174:Cdc45 UTSW 16 18794704 intron probably null
R6796:Cdc45 UTSW 16 18784857 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGATTGTACTTTACACCCAAG -3'
(R):5'- CTGCATGAGTCAGAGCTCTG -3'

Sequencing Primer
(F):5'- CCCAAGTAAGTCACATCAGAGTGG -3'
(R):5'- AGCTCTGAGGTCTACTGGC -3'
Posted On2016-06-06