Mutagenetix > Incidental Mutations

Incidental Mutation 'R5028:Slc8a1'

391537

Institutional Source

Beutler Lab

Gene Symbol

Slc8a1

Ensembl Gene

ENSMUSG00000054640

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 1

Synonyms

Ncx1, D930008O12Rik

MMRRC Submission

042619-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5028 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81388691-81649607 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81649273 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 112 (I112T)

Ref Sequence

ENSEMBL: ENSMUSP00000126373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086538] [ENSMUST00000163123] [ENSMUST00000163680]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000086538
AA Change: I112T

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000083725
Gene: ENSMUSG00000054640
AA Change: I112T

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	77	248	3.8e-38	PFAM
Pfam:Na_Ca_ex_C	251	386	2e-53	PFAM
Calx_beta	393	493	1.28e-49	SMART
Calx_beta	524	624	8.25e-44	SMART
low complexity region	754	765	N/A	INTRINSIC
Pfam:Na_Ca_ex	796	961	2.4e-29	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163123
AA Change: I112T

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000132809
Gene: ENSMUSG00000054640
AA Change: I112T

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	87	246	4.6e-38	PFAM
coiled coil region	313	332	N/A	INTRINSIC
Calx_beta	393	493	1.28e-49	SMART
Calx_beta	524	624	8.25e-44	SMART
low complexity region	742	753	N/A	INTRINSIC
Pfam:Na_Ca_ex	794	947	1.2e-28	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163680
AA Change: I112T

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126373
Gene: ENSMUSG00000054640
AA Change: I112T

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	77	248	3.8e-38	PFAM
Pfam:Na_Ca_ex_C	251	386	2e-53	PFAM
Calx_beta	393	493	1.28e-49	SMART
Calx_beta	524	624	8.25e-44	SMART
low complexity region	754	765	N/A	INTRINSIC
Pfam:Na_Ca_ex	796	961	2.4e-29	PFAM

Meta Mutation Damage Score

0.1028

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

97% (62/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In cardiac myocytes, Ca(2+) concentrations alternate between high levels during contraction and low levels during relaxation. The increase in Ca(2+) concentration during contraction is primarily due to release of Ca(2+) from intracellular stores. However, some Ca(2+) also enters the cell through the sarcolemma (plasma membrane). During relaxation, Ca(2+) is sequestered within the intracellular stores. To prevent overloading of intracellular stores, the Ca(2+) that entered across the sarcolemma must be extruded from the cell. The Na(+)-Ca(2+) exchanger is the primary mechanism by which the Ca(2+) is extruded from the cell during relaxation. In the heart, the exchanger may play a key role in digitalis action. The exchanger is the dominant mechanism in returning the cardiac myocyte to its resting state following excitation.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygotes for targeted null mutations have underdeveloped, nonbeating hearts with massive apoptosis of myocytes, a dilated pericardium and die around embryonic day 9.5. Heterozygotes exhibit altered responses to experimental cardiac pressure overload. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	T	A	2: 69,274,012	S777C	probably damaging	Het
Ano5	T	A	7: 51,537,710		probably null	Het
Arhgap17	T	A	7: 123,294,673	H508L	probably benign	Het
Arhgap29	T	A	3: 122,010,060		probably null	Het
Atp12a	T	C	14: 56,386,978	F961S	probably damaging	Het
B4galnt4	C	A	7: 141,068,062	P497Q	probably benign	Het
Camsap1	A	G	2: 25,944,556	S364P	probably damaging	Het
Ccdc150	C	A	1: 54,263,477	D85E	probably benign	Het
Cdc45	A	G	16: 18,795,180	Y291H	probably benign	Het
Comp	A	C	8: 70,376,640	N289T	probably damaging	Het
Cops3	T	A	11: 59,818,030		probably benign	Het
Crybg1	G	A	10: 43,998,212	H967Y	possibly damaging	Het
Csmd1	A	T	8: 15,989,090	F2423I	probably damaging	Het
Dact1	C	A	12: 71,318,573	C709*	probably null	Het
Dcxr	T	G	11: 120,726,447	Q90P	probably damaging	Het
Ell	A	G	8: 70,590,699	Y494C	probably damaging	Het
Emilin2	T	C	17: 71,274,732	E333G	possibly damaging	Het
Eml2	T	C	7: 19,179,447		probably null	Het
Fam186b	T	A	15: 99,280,801	M215L	probably damaging	Het
Gm17078	T	A	14: 51,611,242	R13W	probably null	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Hspa14	A	G	2: 3,498,169	F196S	possibly damaging	Het
Ier5	A	G	1: 155,099,103	S110P	possibly damaging	Het
Kif1a	T	A	1: 93,054,327	I793F	possibly damaging	Het
Lrrc43	T	C	5: 123,508,113	I643T	probably damaging	Het
Map3k19	A	T	1: 127,823,232	L794Q	probably benign	Het
Meox2	A	T	12: 37,108,936	M36L	probably benign	Het
Mgat5b	T	A	11: 116,985,029	L693Q	probably damaging	Het
Mup4	T	A	4: 59,958,124	E148V	possibly damaging	Het
Napb	T	C	2: 148,703,137	N162S	possibly damaging	Het
Nlgn2	T	C	11: 69,827,737	D339G	probably benign	Het
Nucks1	C	T	1: 131,928,102	R90C	possibly damaging	Het
Olfr1431	T	A	19: 12,210,154	V196E	possibly damaging	Het
Olfr740	T	C	14: 50,453,739	V229A	probably damaging	Het
Plekhd1	A	T	12: 80,692,949	D24V	probably damaging	Het
Prpf4b	C	T	13: 34,899,975	P909L	probably damaging	Het
Rasgrp1	T	A	2: 117,302,004	K116*	probably null	Het
Ror1	A	G	4: 100,411,936	T324A	possibly damaging	Het
Slc24a4	G	A	12: 102,264,370	G505R	probably damaging	Het
Smarcc2	A	G	10: 128,461,445	S69G	probably damaging	Het
Smc2	A	T	4: 52,458,447	E429D	probably damaging	Het
Sry	T	C	Y: 2,663,312	D116G	probably damaging	Het
Tcea3	T	A	4: 136,257,935	V154E	possibly damaging	Het
Tigd2	G	A	6: 59,211,220	W357*	probably null	Het
Tmem177	T	A	1: 119,910,689	T87S	probably benign	Het
Treh	A	T	9: 44,682,889	E144V	probably null	Het
Trpm6	T	A	19: 18,786,760	D243E	probably damaging	Het
Ttn	T	C	2: 76,778,050	D17843G	probably damaging	Het
Vars2	A	C	17: 35,659,473		probably null	Het
Vmn1r201	G	A	13: 22,475,360	W248*	probably null	Het
Yap1	T	C	9: 8,001,689	T99A	probably benign	Het
Zbtb8b	C	A	4: 129,433,000	C91F	probably damaging	Het
Zfp882	A	G	8: 71,914,654	T442A	possibly damaging	Het
Zxdc	G	T	6: 90,382,338	G651C	probably benign	Het

Other mutations in Slc8a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00549:Slc8a1	APN	17	81649171	missense	probably damaging	1.00
IGL00572:Slc8a1	APN	17	81388726	missense	probably damaging	1.00
IGL00777:Slc8a1	APN	17	81648580	missense	probably damaging	1.00
IGL00857:Slc8a1	APN	17	81647879	missense	probably benign	0.03
IGL01068:Slc8a1	APN	17	81388942	missense	probably benign	0.09
IGL01089:Slc8a1	APN	17	81648281	missense	probably damaging	1.00
IGL01089:Slc8a1	APN	17	81388881	missense	probably damaging	1.00
IGL01510:Slc8a1	APN	17	81648365	missense	probably damaging	1.00
IGL01677:Slc8a1	APN	17	81648607	missense	probably damaging	1.00
IGL01862:Slc8a1	APN	17	81442201	critical splice donor site	probably null
IGL02003:Slc8a1	APN	17	81428196	missense	possibly damaging	0.80
IGL02500:Slc8a1	APN	17	81388713	missense	probably damaging	1.00
IGL02556:Slc8a1	APN	17	81648744	missense	probably benign	0.24
IGL02800:Slc8a1	APN	17	81408323	missense	probably benign	0.01
IGL03308:Slc8a1	APN	17	81442195	unclassified	probably benign
IGL03391:Slc8a1	APN	17	81432638	splice site	probably benign
cardinal	UTSW	17	81648407	missense	probably damaging	0.99
encyclical	UTSW	17	81649454	missense	probably damaging	1.00
PIT4498001:Slc8a1	UTSW	17	81648840	nonsense	probably null
R0067:Slc8a1	UTSW	17	81437759	missense	probably benign	0.00
R0067:Slc8a1	UTSW	17	81437759	missense	probably benign	0.00
R0485:Slc8a1	UTSW	17	81647993	missense	probably damaging	0.99
R0667:Slc8a1	UTSW	17	81648881	missense	probably damaging	1.00
R0845:Slc8a1	UTSW	17	81437748	missense	probably benign	0.05
R1073:Slc8a1	UTSW	17	81648407	missense	probably damaging	0.99
R1417:Slc8a1	UTSW	17	81408280	missense	probably damaging	1.00
R1510:Slc8a1	UTSW	17	81648118	missense	probably damaging	1.00
R1546:Slc8a1	UTSW	17	81648247	missense	probably damaging	1.00
R1625:Slc8a1	UTSW	17	81649241	missense	probably damaging	1.00
R1806:Slc8a1	UTSW	17	81648487	missense	probably damaging	1.00
R1879:Slc8a1	UTSW	17	81648013	missense	probably damaging	1.00
R2025:Slc8a1	UTSW	17	81649112	missense	probably damaging	1.00
R2187:Slc8a1	UTSW	17	81648553	missense	possibly damaging	0.48
R2198:Slc8a1	UTSW	17	81408256	nonsense	probably null
R3856:Slc8a1	UTSW	17	81648374	missense	probably benign
R4067:Slc8a1	UTSW	17	81648274	missense	probably damaging	1.00
R4224:Slc8a1	UTSW	17	81649352	missense	probably damaging	1.00
R4225:Slc8a1	UTSW	17	81649352	missense	probably damaging	1.00
R5307:Slc8a1	UTSW	17	81649224	missense	probably damaging	1.00
R5766:Slc8a1	UTSW	17	81648961	missense	probably damaging	0.97
R5787:Slc8a1	UTSW	17	81388737	missense	probably damaging	1.00
R5902:Slc8a1	UTSW	17	81408082	missense	probably damaging	1.00
R5913:Slc8a1	UTSW	17	81648002	missense	probably damaging	1.00
R6017:Slc8a1	UTSW	17	81648254	missense	probably damaging	1.00
R6481:Slc8a1	UTSW	17	81388918	missense	probably benign
R6670:Slc8a1	UTSW	17	81649454	missense	probably damaging	1.00
R6714:Slc8a1	UTSW	17	81408249	missense	probably damaging	1.00
R6914:Slc8a1	UTSW	17	81408120	missense	probably damaging	1.00
R6919:Slc8a1	UTSW	17	81388872	missense	probably damaging	1.00
R6942:Slc8a1	UTSW	17	81408120	missense	probably damaging	1.00
R7057:Slc8a1	UTSW	17	81649095	missense	probably damaging	1.00
R7431:Slc8a1	UTSW	17	81441663	missense	probably benign	0.00
R7447:Slc8a1	UTSW	17	81649006	missense	probably damaging	1.00
R7480:Slc8a1	UTSW	17	81649220	missense	probably damaging	1.00
R7572:Slc8a1	UTSW	17	81441771	critical splice donor site	probably null
R8056:Slc8a1	UTSW	17	81647923	missense	probably damaging	1.00
R8326:Slc8a1	UTSW	17	81408106	missense	probably damaging	0.98
X0024:Slc8a1	UTSW	17	81432762	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- GTTAAAGGCAGCACTTCCCAC -3'
(R):5'- AACCACTGAATGTACTGGCTC -3'

Sequencing Primer
(F):5'- ACTTCCCACGATGGTGCTG -3'
(R):5'- CCACTGAATGTACTGGCTCATATTAC -3'

Posted On

2016-06-06