Mutagenetix > Incidental Mutation

Incidental Mutation 'R5028:Trpm6'

391539

Institutional Source

Beutler Lab

Gene Symbol

Trpm6

Ensembl Gene

ENSMUSG00000024727

Gene Name

transient receptor potential cation channel, subfamily M, member 6

Synonyms

CHAK2

MMRRC Submission

042619-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5028 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

18749983-18892510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 18786760 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 243 (D243E)

Ref Sequence

ENSEMBL: ENSMUSP00000037443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040489]

AlphaFold

Q8CIR4

Predicted Effect

probably damaging
Transcript: ENSMUST00000040489
AA Change: D243E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: D243E

Domain	Start	End	E-Value	Type
Blast:ANK	430	459	4e-8	BLAST
low complexity region	580	604	N/A	INTRINSIC
transmembrane domain	749	766	N/A	INTRINSIC
Pfam:Ion_trans	847	1087	2.8e-13	PFAM
low complexity region	1113	1126	N/A	INTRINSIC
low complexity region	1136	1154	N/A	INTRINSIC
Pfam:TRPM_tetra	1176	1231	7.5e-27	PFAM
low complexity region	1320	1331	N/A	INTRINSIC
low complexity region	1578	1596	N/A	INTRINSIC
Blast:Alpha_kinase	1618	1673	9e-11	BLAST
low complexity region	1682	1695	N/A	INTRINSIC
Alpha_kinase	1761	1978	1e-84	SMART

Meta Mutation Damage Score

0.9396

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

97% (62/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	T	A	2: 69,274,012	S777C	probably damaging	Het
Ano5	T	A	7: 51,537,710		probably null	Het
Arhgap17	T	A	7: 123,294,673	H508L	probably benign	Het
Arhgap29	T	A	3: 122,010,060		probably null	Het
Atp12a	T	C	14: 56,386,978	F961S	probably damaging	Het
B4galnt4	C	A	7: 141,068,062	P497Q	probably benign	Het
Camsap1	A	G	2: 25,944,556	S364P	probably damaging	Het
Ccdc150	C	A	1: 54,263,477	D85E	probably benign	Het
Cdc45	A	G	16: 18,795,180	Y291H	probably benign	Het
Comp	A	C	8: 70,376,640	N289T	probably damaging	Het
Cops3	T	A	11: 59,818,030		probably benign	Het
Crybg1	G	A	10: 43,998,212	H967Y	possibly damaging	Het
Csmd1	A	T	8: 15,989,090	F2423I	probably damaging	Het
Dact1	C	A	12: 71,318,573	C709*	probably null	Het
Dcxr	T	G	11: 120,726,447	Q90P	probably damaging	Het
Ell	A	G	8: 70,590,699	Y494C	probably damaging	Het
Emilin2	T	C	17: 71,274,732	E333G	possibly damaging	Het
Eml2	T	C	7: 19,179,447		probably null	Het
Fam186b	T	A	15: 99,280,801	M215L	probably damaging	Het
Gm17078	T	A	14: 51,611,242	R13W	probably null	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Hspa14	A	G	2: 3,498,169	F196S	possibly damaging	Het
Ier5	A	G	1: 155,099,103	S110P	possibly damaging	Het
Kif1a	T	A	1: 93,054,327	I793F	possibly damaging	Het
Lrrc43	T	C	5: 123,508,113	I643T	probably damaging	Het
Map3k19	A	T	1: 127,823,232	L794Q	probably benign	Het
Meox2	A	T	12: 37,108,936	M36L	probably benign	Het
Mgat5b	T	A	11: 116,985,029	L693Q	probably damaging	Het
Mup4	T	A	4: 59,958,124	E148V	possibly damaging	Het
Napb	T	C	2: 148,703,137	N162S	possibly damaging	Het
Nlgn2	T	C	11: 69,827,737	D339G	probably benign	Het
Nucks1	C	T	1: 131,928,102	R90C	possibly damaging	Het
Olfr1431	T	A	19: 12,210,154	V196E	possibly damaging	Het
Olfr740	T	C	14: 50,453,739	V229A	probably damaging	Het
Plekhd1	A	T	12: 80,692,949	D24V	probably damaging	Het
Prpf4b	C	T	13: 34,899,975	P909L	probably damaging	Het
Rasgrp1	T	A	2: 117,302,004	K116*	probably null	Het
Ror1	A	G	4: 100,411,936	T324A	possibly damaging	Het
Slc24a4	G	A	12: 102,264,370	G505R	probably damaging	Het
Slc8a1	A	G	17: 81,649,273	I112T	possibly damaging	Het
Smarcc2	A	G	10: 128,461,445	S69G	probably damaging	Het
Smc2	A	T	4: 52,458,447	E429D	probably damaging	Het
Sry	T	C	Y: 2,663,312	D116G	probably damaging	Het
Tcea3	T	A	4: 136,257,935	V154E	possibly damaging	Het
Tigd2	G	A	6: 59,211,220	W357*	probably null	Het
Tmem177	T	A	1: 119,910,689	T87S	probably benign	Het
Treh	A	T	9: 44,682,889	E144V	probably null	Het
Ttn	T	C	2: 76,778,050	D17843G	probably damaging	Het
Vars2	A	C	17: 35,659,473		probably null	Het
Vmn1r201	G	A	13: 22,475,360	W248*	probably null	Het
Yap1	T	C	9: 8,001,689	T99A	probably benign	Het
Zbtb8b	C	A	4: 129,433,000	C91F	probably damaging	Het
Zfp882	A	G	8: 71,914,654	T442A	possibly damaging	Het
Zxdc	G	T	6: 90,382,338	G651C	probably benign	Het

Other mutations in Trpm6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Trpm6	APN	19	18783908	splice site	probably benign
IGL00862:Trpm6	APN	19	18827528	missense	probably damaging	1.00
IGL01348:Trpm6	APN	19	18877651	missense	probably damaging	1.00
IGL01400:Trpm6	APN	19	18825794	nonsense	probably null
IGL01451:Trpm6	APN	19	18809569	missense	probably damaging	1.00
IGL01508:Trpm6	APN	19	18796530	nonsense	probably null
IGL01995:Trpm6	APN	19	18830327	splice site	probably benign
IGL02092:Trpm6	APN	19	18772331	missense	possibly damaging	0.59
IGL02152:Trpm6	APN	19	18832539	missense	possibly damaging	0.93
IGL02294:Trpm6	APN	19	18854063	missense	probably benign
IGL02329:Trpm6	APN	19	18854217	missense	probably benign	0.17
IGL02366:Trpm6	APN	19	18778510	splice site	probably benign
IGL02402:Trpm6	APN	19	18786756	missense	probably benign	0.18
IGL02457:Trpm6	APN	19	18825791	missense	probably damaging	1.00
IGL02457:Trpm6	APN	19	18827398	nonsense	probably null
IGL02684:Trpm6	APN	19	18802207	splice site	probably benign
IGL02705:Trpm6	APN	19	18776733	critical splice donor site	probably null
IGL02728:Trpm6	APN	19	18809652	missense	possibly damaging	0.71
IGL02742:Trpm6	APN	19	18830012	splice site	probably benign
IGL02818:Trpm6	APN	19	18866257	missense	probably benign	0.04
IGL02836:Trpm6	APN	19	18813482	missense	probably damaging	1.00
IGL03119:Trpm6	APN	19	18838017	nonsense	probably null
IGL03193:Trpm6	APN	19	18825872	missense	possibly damaging	0.94
IGL03227:Trpm6	APN	19	18819119	missense	probably benign	0.01
IGL03227:Trpm6	APN	19	18786779	missense	probably benign	0.12
IGL03231:Trpm6	APN	19	18819181	missense	probably benign
IGL03245:Trpm6	APN	19	18877701	missense	probably damaging	1.00
IGL03328:Trpm6	APN	19	18838082	missense	possibly damaging	0.94
IGL03341:Trpm6	APN	19	18813486	missense	probably benign
P0043:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
PIT4260001:Trpm6	UTSW	19	18825802	missense	possibly damaging	0.48
R0057:Trpm6	UTSW	19	18786755	missense	probably benign	0.05
R0115:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R0119:Trpm6	UTSW	19	18832593	missense	probably benign	0.05
R0140:Trpm6	UTSW	19	18819194	splice site	probably null
R0267:Trpm6	UTSW	19	18823378	missense	probably benign
R0350:Trpm6	UTSW	19	18883957	splice site	probably null
R0373:Trpm6	UTSW	19	18853587	missense	probably benign	0.15
R0393:Trpm6	UTSW	19	18778644	missense	probably damaging	0.99
R0416:Trpm6	UTSW	19	18783025	splice site	probably benign
R0505:Trpm6	UTSW	19	18873902	splice site	probably benign
R0526:Trpm6	UTSW	19	18792876	missense	probably damaging	0.97
R0607:Trpm6	UTSW	19	18872221	missense	probably benign	0.00
R0609:Trpm6	UTSW	19	18825862	missense	probably damaging	0.97
R0714:Trpm6	UTSW	19	18838087	missense	possibly damaging	0.90
R1215:Trpm6	UTSW	19	18796498	missense	probably damaging	1.00
R1474:Trpm6	UTSW	19	18796495	missense	probably benign	0.28
R1512:Trpm6	UTSW	19	18875931	missense	probably benign
R1558:Trpm6	UTSW	19	18786828	missense	probably benign	0.04
R1597:Trpm6	UTSW	19	18827524	missense	probably damaging	0.98
R1618:Trpm6	UTSW	19	18877631	missense	possibly damaging	0.88
R1779:Trpm6	UTSW	19	18856217	missense	probably damaging	1.00
R1796:Trpm6	UTSW	19	18827567	missense	possibly damaging	0.90
R1799:Trpm6	UTSW	19	18891999	splice site	probably null
R1840:Trpm6	UTSW	19	18866267	missense	probably benign	0.21
R1991:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2030:Trpm6	UTSW	19	18854265	missense	probably benign
R2073:Trpm6	UTSW	19	18876042	missense	probably damaging	1.00
R2074:Trpm6	UTSW	19	18877739	missense	probably damaging	1.00
R2096:Trpm6	UTSW	19	18825752	missense	probably damaging	0.97
R2103:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2106:Trpm6	UTSW	19	18813350	missense	possibly damaging	0.95
R2117:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R2850:Trpm6	UTSW	19	18792090	missense	possibly damaging	0.68
R3125:Trpm6	UTSW	19	18854431	missense	probably benign	0.05
R3719:Trpm6	UTSW	19	18772393	nonsense	probably null
R3779:Trpm6	UTSW	19	18876039	missense	possibly damaging	0.80
R4115:Trpm6	UTSW	19	18832557	missense	probably damaging	1.00
R4367:Trpm6	UTSW	19	18827525	missense	probably damaging	0.99
R4523:Trpm6	UTSW	19	18796500	missense	probably damaging	1.00
R4546:Trpm6	UTSW	19	18832477	missense	probably damaging	1.00
R4564:Trpm6	UTSW	19	18832597	missense	possibly damaging	0.95
R4565:Trpm6	UTSW	19	18825872	missense	probably damaging	1.00
R4697:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R4714:Trpm6	UTSW	19	18854200	missense	possibly damaging	0.93
R4750:Trpm6	UTSW	19	18876064	missense	probably damaging	0.99
R4771:Trpm6	UTSW	19	18813493	missense	probably damaging	0.97
R4791:Trpm6	UTSW	19	18867981	missense	probably benign	0.00
R4814:Trpm6	UTSW	19	18862212	missense	probably benign	0.11
R5237:Trpm6	UTSW	19	18813464	missense	probably damaging	1.00
R5615:Trpm6	UTSW	19	18829933	missense	probably damaging	0.96
R5642:Trpm6	UTSW	19	18830207	missense	probably damaging	1.00
R5645:Trpm6	UTSW	19	18853604	missense	probably damaging	1.00
R5726:Trpm6	UTSW	19	18853617	missense	probably damaging	1.00
R5832:Trpm6	UTSW	19	18786819	missense	possibly damaging	0.66
R5843:Trpm6	UTSW	19	18856175	missense	probably benign	0.04
R5955:Trpm6	UTSW	19	18892019	missense	possibly damaging	0.75
R6101:Trpm6	UTSW	19	18853748	nonsense	probably null
R6105:Trpm6	UTSW	19	18853748	nonsense	probably null
R6211:Trpm6	UTSW	19	18783128	missense	probably damaging	1.00
R6228:Trpm6	UTSW	19	18854291	missense	probably damaging	1.00
R6263:Trpm6	UTSW	19	18854108	missense	possibly damaging	0.94
R6453:Trpm6	UTSW	19	18829990	missense	probably damaging	1.00
R6562:Trpm6	UTSW	19	18838042	missense	probably damaging	1.00
R6624:Trpm6	UTSW	19	18796439	critical splice acceptor site	probably null
R6624:Trpm6	UTSW	19	18889020	missense	probably damaging	1.00
R6729:Trpm6	UTSW	19	18830297	missense	probably damaging	1.00
R6765:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
R6976:Trpm6	UTSW	19	18783163	missense	probably benign
R7103:Trpm6	UTSW	19	18813547	missense	possibly damaging	0.87
R7126:Trpm6	UTSW	19	18854033	nonsense	probably null
R7128:Trpm6	UTSW	19	18811773	missense	possibly damaging	0.92
R7157:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R7212:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R7263:Trpm6	UTSW	19	18876786	missense	probably damaging	1.00
R7268:Trpm6	UTSW	19	18778585	missense	probably benign	0.13
R7305:Trpm6	UTSW	19	18876091	missense	probably benign	0.30
R7498:Trpm6	UTSW	19	18876120	missense	probably damaging	1.00
R7558:Trpm6	UTSW	19	18778665	missense	probably damaging	0.96
R7590:Trpm6	UTSW	19	18832581	missense	probably benign	0.31
R7646:Trpm6	UTSW	19	18867961	missense	probably benign	0.10
R7650:Trpm6	UTSW	19	18876013	missense	possibly damaging	0.70
R7727:Trpm6	UTSW	19	18854249	missense	probably damaging	0.97
R7743:Trpm6	UTSW	19	18827408	missense	probably benign	0.03
R7747:Trpm6	UTSW	19	18750045	splice site	probably null
R7807:Trpm6	UTSW	19	18829856	missense	probably benign	0.11
R7870:Trpm6	UTSW	19	18815241	missense	probably benign	0.01
R7891:Trpm6	UTSW	19	18776710	missense	probably benign	0.01
R7955:Trpm6	UTSW	19	18854290	missense	probably benign	0.01
R7965:Trpm6	UTSW	19	18876110	missense	probably damaging	1.00
R7967:Trpm6	UTSW	19	18778659	missense	probably damaging	0.99
R7992:Trpm6	UTSW	19	18815350	missense	probably damaging	1.00
R8035:Trpm6	UTSW	19	18792862	missense	probably damaging	0.97
R8108:Trpm6	UTSW	19	18811790	missense	probably damaging	1.00
R8268:Trpm6	UTSW	19	18873861	missense	possibly damaging	0.85
R8411:Trpm6	UTSW	19	18853968	missense	probably benign	0.39
R8413:Trpm6	UTSW	19	18832485	missense	probably benign	0.00
R8534:Trpm6	UTSW	19	18892095	missense	probably benign	0.00
R8932:Trpm6	UTSW	19	18838002	missense	possibly damaging	0.87
R8990:Trpm6	UTSW	19	18815435	missense	probably damaging	1.00
R9403:Trpm6	UTSW	19	18832652	missense	possibly damaging	0.84
R9446:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R9463:Trpm6	UTSW	19	18783900	critical splice donor site	probably null
R9485:Trpm6	UTSW	19	18778614	missense	probably benign	0.06
R9536:Trpm6	UTSW	19	18786759	missense	probably damaging	1.00
R9549:Trpm6	UTSW	19	18876030	nonsense	probably null
R9564:Trpm6	UTSW	19	18873876	missense	possibly damaging	0.92
R9626:Trpm6	UTSW	19	18813482	missense	probably damaging	1.00
R9655:Trpm6	UTSW	19	18892102	missense	probably benign
R9721:Trpm6	UTSW	19	18829972	missense	probably benign	0.12
R9742:Trpm6	UTSW	19	18823402	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- CCTTCATTAGTGTATAGGGACGG -3'
(R):5'- TACATCTGTGTTAACTGGCTGCTC -3'

Sequencing Primer
(F):5'- TGTATAGGGACGGGGTTTAGAAC -3'
(R):5'- AACTGGCTGCTCTGGATGCTC -3'

Posted On

2016-06-06