Incidental Mutation 'R5029:Olfr1057'
ID391545
Institutional Source Beutler Lab
Gene Symbol Olfr1057
Ensembl Gene ENSMUSG00000075187
Gene Nameolfactory receptor 1057
SynonymsGA_x6K02T2Q125-47844843-47843896, MOR185-11
MMRRC Submission 042620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5029 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86372561-86378393 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86374890 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 174 (I174T)
Ref Sequence ENSEMBL: ENSMUSP00000150623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099892] [ENSMUST00000217435]
Predicted Effect probably damaging
Transcript: ENSMUST00000099892
AA Change: I174T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097477
Gene: ENSMUSG00000075187
AA Change: I174T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.3e-47 PFAM
Pfam:7tm_1 41 290 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217435
AA Change: I174T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Ank T C 15: 27,590,353 V341A probably benign Het
Bnip3 T A 7: 138,898,119 probably benign Het
C1galt1 A G 6: 7,863,931 K4E possibly damaging Het
Cbs T A 17: 31,615,482 Q511L possibly damaging Het
Ccdc117 T C 11: 5,534,897 H109R possibly damaging Het
Cdh4 T A 2: 179,881,949 V440D possibly damaging Het
Cnot4 T C 6: 35,078,027 N109S probably damaging Het
Dact2 A T 17: 14,195,852 S695R probably benign Het
Defa21 A T 8: 21,026,365 E75V probably damaging Het
Dimt1 A G 13: 106,957,122 D274G probably null Het
Dstyk G T 1: 132,449,324 V223L probably benign Het
Dync1h1 T A 12: 110,618,010 S616T possibly damaging Het
Fer1l6 A T 15: 58,643,920 I1619F probably benign Het
Gm4744 T A 6: 40,949,407 Y83F probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hpx T G 7: 105,591,764 Y434S probably damaging Het
Ints4 A G 7: 97,509,774 D451G probably benign Het
Itgb4 A T 11: 115,988,591 probably benign Het
Jph1 T A 1: 17,091,391 N349I possibly damaging Het
Klrg1 A G 6: 122,282,735 L26P probably benign Het
M1ap A C 6: 83,003,832 D233A probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mycbp2 A G 14: 103,156,510 S2762P probably benign Het
Myh11 T A 16: 14,205,625 Q1556L probably damaging Het
N4bp2 A G 5: 65,814,780 D1428G probably damaging Het
Ndc80 A C 17: 71,508,765 C342G probably benign Het
Nxn A C 11: 76,274,530 Y199* probably null Het
Olfr371 C T 8: 85,231,206 A237V probably benign Het
Olfr776 T A 10: 129,261,838 N292K probably benign Het
Pacs1 A G 19: 5,142,271 F691L probably benign Het
Pcdhga12 T C 18: 37,766,811 V232A probably benign Het
Pik3cb A T 9: 99,054,060 M773K probably damaging Het
Plxnb1 T C 9: 109,114,655 Y1937H probably damaging Het
Ppfia2 C A 10: 106,857,443 T603N probably benign Het
Psg22 A G 7: 18,719,737 Y119C probably damaging Het
Saraf G T 8: 34,161,258 R86L probably damaging Het
Sh3bgrl2 T C 9: 83,548,489 S11P possibly damaging Het
Slc39a4 C T 15: 76,614,083 D385N probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stpg3 T C 2: 25,214,564 N13S probably damaging Het
Taf1a T A 1: 183,395,935 D50E possibly damaging Het
Tlr1 T A 5: 64,925,681 N518Y probably damaging Het
Tnik G A 3: 28,665,844 probably null Het
Tomm70a T A 16: 57,122,151 L97Q probably benign Het
Vmn2r97 T A 17: 18,947,911 V809E probably damaging Het
Vps13d T C 4: 145,156,282 I914V probably benign Het
Zfyve26 A T 12: 79,286,323 H291Q probably damaging Het
Zmynd15 G T 11: 70,462,561 C334F probably damaging Het
Other mutations in Olfr1057
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02403:Olfr1057 APN 2 86374523 missense probably benign 0.05
IGL03267:Olfr1057 APN 2 86374634 nonsense probably null
R0133:Olfr1057 UTSW 2 86374815 missense possibly damaging 0.95
R0993:Olfr1057 UTSW 2 86374878 missense probably damaging 0.99
R1386:Olfr1057 UTSW 2 86374921 missense probably damaging 1.00
R1830:Olfr1057 UTSW 2 86375143 missense possibly damaging 0.95
R2398:Olfr1057 UTSW 2 86374839 missense probably damaging 0.98
R3753:Olfr1057 UTSW 2 86374915 missense possibly damaging 0.53
R4394:Olfr1057 UTSW 2 86375179 missense possibly damaging 0.77
R4605:Olfr1057 UTSW 2 86374797 missense probably benign 0.01
R4835:Olfr1057 UTSW 2 86374509 missense possibly damaging 0.93
R5311:Olfr1057 UTSW 2 86374750 missense possibly damaging 0.91
R7487:Olfr1057 UTSW 2 86375131 missense probably damaging 1.00
R7667:Olfr1057 UTSW 2 86375181 missense probably damaging 0.99
R7770:Olfr1057 UTSW 2 86375260 missense possibly damaging 0.53
R7888:Olfr1057 UTSW 2 86374926 missense probably benign 0.02
R7971:Olfr1057 UTSW 2 86374926 missense probably benign 0.02
Z1176:Olfr1057 UTSW 2 86375115 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGCACAAGTAGAGAAGGCTTTC -3'
(R):5'- AGCAGAGATCTTTATGCTGGC -3'

Sequencing Primer
(F):5'- CCTTCCTTCAGATGAACGGATC -3'
(R):5'- GCTGTGATGGCCTATGACC -3'
Posted On2016-06-06