Mutagenetix > Incidental Mutations

Incidental Mutation 'R5029:N4bp2'

391551

Institutional Source

Beutler Lab

Gene Symbol

N4bp2

Ensembl Gene

ENSMUSG00000037795

Gene Name

NEDD4 binding protein 2

Synonyms

B3bp, LOC333789, LOC386488

MMRRC Submission

042620-MU

Accession Numbers

Genbank: NM_001024917.1; Ensembl: ENSMUST00000113738

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R5029 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65763521-65830108 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65814780 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1428 (D1428G)

Ref Sequence

ENSEMBL: ENSMUSP00000144278 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087264] [ENSMUST00000201489] [ENSMUST00000201615]

Predicted Effect

probably damaging
Transcript: ENSMUST00000087264
AA Change: D1428G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084519
Gene: ENSMUSG00000037795
AA Change: D1428G

Domain	Start	End	E-Value	Type
low complexity region	109	130	N/A	INTRINSIC
low complexity region	271	283	N/A	INTRINSIC
Pfam:AAA_33	365	499	1.1e-15	PFAM
low complexity region	533	546	N/A	INTRINSIC
low complexity region	619	629	N/A	INTRINSIC
low complexity region	681	692	N/A	INTRINSIC
low complexity region	847	864	N/A	INTRINSIC
low complexity region	1079	1090	N/A	INTRINSIC
Blast:CUE	1430	1472	1e-9	BLAST
low complexity region	1496	1511	N/A	INTRINSIC
DUF1771	1526	1591	1.88e-21	SMART
SMR	1596	1678	1.09e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127411
AA Change: D99G

Predicted Effect

probably damaging
Transcript: ENSMUST00000201489
AA Change: D1428G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143807
Gene: ENSMUSG00000037795
AA Change: D1428G

Domain	Start	End	E-Value	Type
low complexity region	109	130	N/A	INTRINSIC
low complexity region	271	283	N/A	INTRINSIC
Pfam:AAA_33	365	499	1e-14	PFAM
low complexity region	533	546	N/A	INTRINSIC
low complexity region	619	629	N/A	INTRINSIC
low complexity region	681	692	N/A	INTRINSIC
low complexity region	847	864	N/A	INTRINSIC
low complexity region	1079	1090	N/A	INTRINSIC
Blast:CUE	1430	1472	1e-9	BLAST
low complexity region	1496	1511	N/A	INTRINSIC
DUF1771	1526	1591	1.88e-21	SMART
SMR	1596	1678	1.09e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000201615
AA Change: D1428G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144278
Gene: ENSMUSG00000037795
AA Change: D1428G

Domain	Start	End	E-Value	Type
low complexity region	109	130	N/A	INTRINSIC
low complexity region	271	283	N/A	INTRINSIC
Pfam:AAA_33	365	499	1.2e-14	PFAM
low complexity region	533	546	N/A	INTRINSIC
low complexity region	619	629	N/A	INTRINSIC
low complexity region	681	692	N/A	INTRINSIC
low complexity region	847	864	N/A	INTRINSIC
low complexity region	1079	1090	N/A	INTRINSIC
Blast:CUE	1430	1472	8e-10	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202411

Meta Mutation Damage Score

0.1123

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.1%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a polynucleotide kinase domain (PNK) near the N-terminal region, and a Small MutS Related (Smr) domain near the C-terminal region. The encoded protein can bind to both B-cell leukemia/lymphoma 3 (BCL-3) and neural precursor cell expressed, developmentally downregulated 4, (Nedd4) proteins. This protein binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. This protein may play a role in transcription-coupled DNA repair or genetic recombination. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]

Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actbl2	T	A	13: 111,255,593	M154K	probably benign	Het
Ank	T	C	15: 27,590,353	V341A	probably benign	Het
Bnip3	T	A	7: 138,898,119		probably benign	Het
C1galt1	A	G	6: 7,863,931	K4E	possibly damaging	Het
Cbs	T	A	17: 31,615,482	Q511L	possibly damaging	Het
Ccdc117	T	C	11: 5,534,897	H109R	possibly damaging	Het
Cdh4	T	A	2: 179,881,949	V440D	possibly damaging	Het
Cnot4	T	C	6: 35,078,027	N109S	probably damaging	Het
Dact2	A	T	17: 14,195,852	S695R	probably benign	Het
Defa21	A	T	8: 21,026,365	E75V	probably damaging	Het
Dimt1	A	G	13: 106,957,122	D274G	probably null	Het
Dstyk	G	T	1: 132,449,324	V223L	probably benign	Het
Dync1h1	T	A	12: 110,618,010	S616T	possibly damaging	Het
Fer1l6	A	T	15: 58,643,920	I1619F	probably benign	Het
Gm4744	T	A	6: 40,949,407	Y83F	probably null	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Hpx	T	G	7: 105,591,764	Y434S	probably damaging	Het
Ints4	A	G	7: 97,509,774	D451G	probably benign	Het
Itgb4	A	T	11: 115,988,591		probably benign	Het
Jph1	T	A	1: 17,091,391	N349I	possibly damaging	Het
Klrg1	A	G	6: 122,282,735	L26P	probably benign	Het
M1ap	A	C	6: 83,003,832	D233A	probably damaging	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Mycbp2	A	G	14: 103,156,510	S2762P	probably benign	Het
Myh11	T	A	16: 14,205,625	Q1556L	probably damaging	Het
Ndc80	A	C	17: 71,508,765	C342G	probably benign	Het
Nxn	A	C	11: 76,274,530	Y199*	probably null	Het
Olfr1057	A	G	2: 86,374,890	I174T	probably damaging	Het
Olfr371	C	T	8: 85,231,206	A237V	probably benign	Het
Olfr776	T	A	10: 129,261,838	N292K	probably benign	Het
Pacs1	A	G	19: 5,142,271	F691L	probably benign	Het
Pcdhga12	T	C	18: 37,766,811	V232A	probably benign	Het
Pik3cb	A	T	9: 99,054,060	M773K	probably damaging	Het
Plxnb1	T	C	9: 109,114,655	Y1937H	probably damaging	Het
Ppfia2	C	A	10: 106,857,443	T603N	probably benign	Het
Psg22	A	G	7: 18,719,737	Y119C	probably damaging	Het
Saraf	G	T	8: 34,161,258	R86L	probably damaging	Het
Sh3bgrl2	T	C	9: 83,548,489	S11P	possibly damaging	Het
Slc39a4	C	T	15: 76,614,083	D385N	probably damaging	Het
St13	G	C	15: 81,399,585	R4G	probably benign	Het
Stpg3	T	C	2: 25,214,564	N13S	probably damaging	Het
Taf1a	T	A	1: 183,395,935	D50E	possibly damaging	Het
Tlr1	T	A	5: 64,925,681	N518Y	probably damaging	Het
Tnik	G	A	3: 28,665,844		probably null	Het
Tomm70a	T	A	16: 57,122,151	L97Q	probably benign	Het
Vmn2r97	T	A	17: 18,947,911	V809E	probably damaging	Het
Vps13d	T	C	4: 145,156,282	I914V	probably benign	Het
Zfyve26	A	T	12: 79,286,323	H291Q	probably damaging	Het
Zmynd15	G	T	11: 70,462,561	C334F	probably damaging	Het

Other mutations in N4bp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:N4bp2	APN	5	65807524	missense	probably damaging	0.96
IGL01503:N4bp2	APN	5	65803547	nonsense	probably null	0.00
IGL01621:N4bp2	APN	5	65790924	missense	probably damaging	1.00
IGL02109:N4bp2	APN	5	65798134	missense	probably damaging	1.00
IGL02286:N4bp2	APN	5	65803552	missense	probably damaging	1.00
1mM(1):N4bp2	UTSW	5	65807677	missense	probably damaging	1.00
IGL03046:N4bp2	UTSW	5	65790960	missense	probably damaging	1.00
R0164:N4bp2	UTSW	5	65803573	splice site	probably benign
R0285:N4bp2	UTSW	5	65806559	missense	probably benign	0.00
R0366:N4bp2	UTSW	5	65806396	missense	possibly damaging	0.95
R0548:N4bp2	UTSW	5	65808153	missense	probably benign	0.39
R0551:N4bp2	UTSW	5	65820341	splice site	probably null
R0671:N4bp2	UTSW	5	65807437	missense	probably damaging	0.99
R1136:N4bp2	UTSW	5	65808472	missense	probably damaging	1.00
R1515:N4bp2	UTSW	5	65790498	missense	probably benign	0.01
R1597:N4bp2	UTSW	5	65807140	missense	probably benign	0.45
R1628:N4bp2	UTSW	5	65803572	splice site	probably null
R1722:N4bp2	UTSW	5	65806882	missense	probably benign	0.08
R1735:N4bp2	UTSW	5	65808316	missense	probably damaging	1.00
R1745:N4bp2	UTSW	5	65790822	missense	probably benign	0.12
R1759:N4bp2	UTSW	5	65826613	missense	probably damaging	1.00
R1799:N4bp2	UTSW	5	65806825	missense	possibly damaging	0.62
R1846:N4bp2	UTSW	5	65808519	missense	probably damaging	1.00
R1872:N4bp2	UTSW	5	65794518	splice site	probably benign
R2042:N4bp2	UTSW	5	65826621	missense	probably damaging	1.00
R2082:N4bp2	UTSW	5	65807565	missense	probably damaging	1.00
R2101:N4bp2	UTSW	5	65790881	missense	probably damaging	1.00
R2147:N4bp2	UTSW	5	65809200	missense	probably damaging	1.00
R2251:N4bp2	UTSW	5	65806728	missense	probably damaging	1.00
R2507:N4bp2	UTSW	5	65790061	missense	probably benign	0.01
R2508:N4bp2	UTSW	5	65790061	missense	probably benign	0.01
R2919:N4bp2	UTSW	5	65807098	missense	probably benign	0.22
R3086:N4bp2	UTSW	5	65791053	missense	probably damaging	1.00
R4092:N4bp2	UTSW	5	65790456	missense	probably benign	0.02
R4177:N4bp2	UTSW	5	65798170	splice site	probably null
R4718:N4bp2	UTSW	5	65803463	missense	probably damaging	1.00
R4859:N4bp2	UTSW	5	65825298	missense	probably damaging	1.00
R4863:N4bp2	UTSW	5	65808130	missense	probably benign	0.22
R4915:N4bp2	UTSW	5	65803504	missense	probably damaging	1.00
R4949:N4bp2	UTSW	5	65821799	splice site	probably null
R4978:N4bp2	UTSW	5	65790240	missense	probably damaging	1.00
R5079:N4bp2	UTSW	5	65811977	missense	probably damaging	1.00
R5097:N4bp2	UTSW	5	65817218	missense	probably damaging	1.00
R5158:N4bp2	UTSW	5	65808462	missense	probably damaging	0.99
R5228:N4bp2	UTSW	5	65807518	missense	probably benign
R5322:N4bp2	UTSW	5	65790457	missense	possibly damaging	0.76
R5554:N4bp2	UTSW	5	65808114	missense	probably benign	0.44
R5731:N4bp2	UTSW	5	65809157	missense	probably damaging	1.00
R5840:N4bp2	UTSW	5	65808094	missense	probably damaging	0.99
R6393:N4bp2	UTSW	5	65791001	missense	possibly damaging	0.81
R6767:N4bp2	UTSW	5	65817187	missense	probably damaging	1.00
R7103:N4bp2	UTSW	5	65806846	missense	probably benign	0.01
R7112:N4bp2	UTSW	5	65790707	missense	possibly damaging	0.74
R7171:N4bp2	UTSW	5	65808022	missense	probably benign	0.00
R7177:N4bp2	UTSW	5	65807548	missense	probably damaging	1.00
R7240:N4bp2	UTSW	5	65794545	missense	probably damaging	0.96
R7353:N4bp2	UTSW	5	65806371	missense	probably benign	0.01
R7450:N4bp2	UTSW	5	65825300	nonsense	probably null
R7560:N4bp2	UTSW	5	65791115	missense	probably damaging	0.99
R7698:N4bp2	UTSW	5	65808157	missense	probably benign	0.00
R7743:N4bp2	UTSW	5	65808459	missense	probably damaging	1.00
R7871:N4bp2	UTSW	5	65807103	missense	probably benign	0.00
R7981:N4bp2	UTSW	5	65812142	missense	probably benign	0.41
R8065:N4bp2	UTSW	5	65807296	missense	probably damaging	0.99
R8067:N4bp2	UTSW	5	65807296	missense	probably damaging	0.99
R8164:N4bp2	UTSW	5	65809223	missense	probably damaging	1.00
R8166:N4bp2	UTSW	5	65820312	missense	probably benign	0.39
R8331:N4bp2	UTSW	5	65807600	missense	probably damaging	1.00
Z1177:N4bp2	UTSW	5	65807637	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTAGCTGGACTGTTGAATAGACTG -3'
(R):5'- ATCACCTGGCAAGTGTGTCC -3'

Sequencing Primer
(F):5'- TTGCTTACTTTATCCTATGATCAGTG -3'
(R):5'- TCCAGGGACACCAGCAAGTG -3'

Posted On

2016-06-06