Incidental Mutation 'R5029:Zmynd15'
ID391571
Institutional Source Beutler Lab
Gene Symbol Zmynd15
Ensembl Gene ENSMUSG00000040829
Gene Namezinc finger, MYND-type containing 15
Synonyms
MMRRC Submission 042620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R5029 (G1)
Quality Score221
Status Validated
Chromosome11
Chromosomal Location70459433-70466202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70462561 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 334 (C334F)
Ref Sequence ENSEMBL: ENSMUSP00000090635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019064] [ENSMUST00000039093] [ENSMUST00000092958] [ENSMUST00000108563] [ENSMUST00000126105] [ENSMUST00000126391] [ENSMUST00000147289]
Predicted Effect probably benign
Transcript: ENSMUST00000019064
SMART Domains Protein: ENSMUSP00000019064
Gene: ENSMUSG00000018920

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:SCY 32 94 1e-17 BLAST
transmembrane domain 201 223 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000039093
AA Change: C335F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048816
Gene: ENSMUSG00000040829
AA Change: C335F

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 164 186 N/A INTRINSIC
Pfam:zf-MYND 307 353 6.7e-12 PFAM
low complexity region 438 452 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 702 736 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092958
AA Change: C334F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090635
Gene: ENSMUSG00000040829
AA Change: C334F

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 164 186 N/A INTRINSIC
Pfam:zf-MYND 306 352 6.5e-11 PFAM
low complexity region 437 451 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
low complexity region 662 696 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108563
AA Change: C205F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104203
Gene: ENSMUSG00000040829
AA Change: C205F

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
Pfam:zf-MYND 177 223 2.5e-11 PFAM
low complexity region 308 322 N/A INTRINSIC
low complexity region 393 405 N/A INTRINSIC
low complexity region 572 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126105
SMART Domains Protein: ENSMUSP00000134599
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126391
SMART Domains Protein: ENSMUSP00000133513
Gene: ENSMUSG00000018920

DomainStartEndE-ValueType
Blast:SCY 19 81 3e-18 BLAST
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136029
Predicted Effect probably benign
Transcript: ENSMUST00000147289
SMART Domains Protein: ENSMUSP00000136813
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154475
Meta Mutation Damage Score 0.7874 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a MYND-containing zinc-binding protein with a nuclear localization sequence. A similar gene in mice has been shown to act as a testis-specific transcriptional repressor by recruiting histone deacetylase enzymes to regulate spatiotemporal expression of many haploid genes. This protein may play an important role in spermatogenesis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele of Cxcl16 and Zmynd15 exhibit abnormal spermiogenesis and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Ank T C 15: 27,590,353 V341A probably benign Het
Bnip3 T A 7: 138,898,119 probably benign Het
C1galt1 A G 6: 7,863,931 K4E possibly damaging Het
Cbs T A 17: 31,615,482 Q511L possibly damaging Het
Ccdc117 T C 11: 5,534,897 H109R possibly damaging Het
Cdh4 T A 2: 179,881,949 V440D possibly damaging Het
Cnot4 T C 6: 35,078,027 N109S probably damaging Het
Dact2 A T 17: 14,195,852 S695R probably benign Het
Defa21 A T 8: 21,026,365 E75V probably damaging Het
Dimt1 A G 13: 106,957,122 D274G probably null Het
Dstyk G T 1: 132,449,324 V223L probably benign Het
Dync1h1 T A 12: 110,618,010 S616T possibly damaging Het
Fer1l6 A T 15: 58,643,920 I1619F probably benign Het
Gm4744 T A 6: 40,949,407 Y83F probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hpx T G 7: 105,591,764 Y434S probably damaging Het
Ints4 A G 7: 97,509,774 D451G probably benign Het
Itgb4 A T 11: 115,988,591 probably benign Het
Jph1 T A 1: 17,091,391 N349I possibly damaging Het
Klrg1 A G 6: 122,282,735 L26P probably benign Het
M1ap A C 6: 83,003,832 D233A probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mycbp2 A G 14: 103,156,510 S2762P probably benign Het
Myh11 T A 16: 14,205,625 Q1556L probably damaging Het
N4bp2 A G 5: 65,814,780 D1428G probably damaging Het
Ndc80 A C 17: 71,508,765 C342G probably benign Het
Nxn A C 11: 76,274,530 Y199* probably null Het
Olfr1057 A G 2: 86,374,890 I174T probably damaging Het
Olfr371 C T 8: 85,231,206 A237V probably benign Het
Olfr776 T A 10: 129,261,838 N292K probably benign Het
Pacs1 A G 19: 5,142,271 F691L probably benign Het
Pcdhga12 T C 18: 37,766,811 V232A probably benign Het
Pik3cb A T 9: 99,054,060 M773K probably damaging Het
Plxnb1 T C 9: 109,114,655 Y1937H probably damaging Het
Ppfia2 C A 10: 106,857,443 T603N probably benign Het
Psg22 A G 7: 18,719,737 Y119C probably damaging Het
Saraf G T 8: 34,161,258 R86L probably damaging Het
Sh3bgrl2 T C 9: 83,548,489 S11P possibly damaging Het
Slc39a4 C T 15: 76,614,083 D385N probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stpg3 T C 2: 25,214,564 N13S probably damaging Het
Taf1a T A 1: 183,395,935 D50E possibly damaging Het
Tlr1 T A 5: 64,925,681 N518Y probably damaging Het
Tnik G A 3: 28,665,844 probably null Het
Tomm70a T A 16: 57,122,151 L97Q probably benign Het
Vmn2r97 T A 17: 18,947,911 V809E probably damaging Het
Vps13d T C 4: 145,156,282 I914V probably benign Het
Zfyve26 A T 12: 79,286,323 H291Q probably damaging Het
Other mutations in Zmynd15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Zmynd15 APN 11 70465916 missense probably damaging 1.00
IGL01351:Zmynd15 APN 11 70463590 missense probably benign 0.28
R0086:Zmynd15 UTSW 11 70464232 missense probably damaging 1.00
R0196:Zmynd15 UTSW 11 70464226 missense probably damaging 1.00
R0667:Zmynd15 UTSW 11 70465118 missense probably damaging 1.00
R1511:Zmynd15 UTSW 11 70464793 missense probably damaging 0.98
R1660:Zmynd15 UTSW 11 70463502 missense probably damaging 1.00
R1750:Zmynd15 UTSW 11 70462567 missense probably benign 0.00
R4344:Zmynd15 UTSW 11 70461068 nonsense probably null
R4594:Zmynd15 UTSW 11 70464182 missense probably damaging 1.00
R4668:Zmynd15 UTSW 11 70462588 missense probably damaging 1.00
R5075:Zmynd15 UTSW 11 70462120 missense probably damaging 1.00
R5289:Zmynd15 UTSW 11 70466004 missense unknown
R5468:Zmynd15 UTSW 11 70461820 missense probably damaging 1.00
R6350:Zmynd15 UTSW 11 70464431 missense probably damaging 1.00
R6665:Zmynd15 UTSW 11 70464810 missense probably benign 0.01
R7078:Zmynd15 UTSW 11 70460755 missense probably damaging 1.00
R7426:Zmynd15 UTSW 11 70462188 missense probably benign 0.06
R7475:Zmynd15 UTSW 11 70461041 missense probably benign
R7673:Zmynd15 UTSW 11 70466040 missense unknown
R8003:Zmynd15 UTSW 11 70460941 missense probably benign 0.00
Z1088:Zmynd15 UTSW 11 70461135 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ACTTGAGCAGTTGGCCAAACC -3'
(R):5'- TATCAAAGACCCGGTCCCAG -3'

Sequencing Primer
(F):5'- AGCAAGCCAGGCCAGTG -3'
(R):5'- AAACTTGCCAGTTCTCCG -3'
Posted On2016-06-06