Incidental Mutation 'R5029:Nxn'
ID391572
Institutional Source Beutler Lab
Gene Symbol Nxn
Ensembl Gene ENSMUSG00000020844
Gene Namenucleoredoxin
Synonymsl11Jus13
MMRRC Submission 042620-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5029 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location76257198-76399140 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 76274530 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 199 (Y199*)
Ref Sequence ENSEMBL: ENSMUSP00000021204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021204]
Predicted Effect probably null
Transcript: ENSMUST00000021204
AA Change: Y199*
SMART Domains Protein: ENSMUSP00000021204
Gene: ENSMUSG00000020844
AA Change: Y199*

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 30 145 5.4e-23 PFAM
Pfam:AhpC-TSA 173 290 4.7e-10 PFAM
Pfam:Thioredoxin_2 189 296 7.1e-11 PFAM
Pfam:Thioredoxin_8 193 287 3.7e-32 PFAM
Pfam:Thioredoxin_6 236 424 8.4e-9 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin superfamily, a group of small, multifunctional redox-active proteins. Members of this family are characterized by a conserved active motif called the thioredoxin fold that catalyzes disulfide bond formation and isomerization. The encoded protein acts a redox-dependent regulator of the Wnt signaling pathway and is involved in cell growth and differentiation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice die by P1 and exhibit craniofacial bone defects and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Ank T C 15: 27,590,353 V341A probably benign Het
Bnip3 T A 7: 138,898,119 probably benign Het
C1galt1 A G 6: 7,863,931 K4E possibly damaging Het
Cbs T A 17: 31,615,482 Q511L possibly damaging Het
Ccdc117 T C 11: 5,534,897 H109R possibly damaging Het
Cdh4 T A 2: 179,881,949 V440D possibly damaging Het
Cnot4 T C 6: 35,078,027 N109S probably damaging Het
Dact2 A T 17: 14,195,852 S695R probably benign Het
Defa21 A T 8: 21,026,365 E75V probably damaging Het
Dimt1 A G 13: 106,957,122 D274G probably null Het
Dstyk G T 1: 132,449,324 V223L probably benign Het
Dync1h1 T A 12: 110,618,010 S616T possibly damaging Het
Fer1l6 A T 15: 58,643,920 I1619F probably benign Het
Gm4744 T A 6: 40,949,407 Y83F probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hpx T G 7: 105,591,764 Y434S probably damaging Het
Ints4 A G 7: 97,509,774 D451G probably benign Het
Itgb4 A T 11: 115,988,591 probably benign Het
Jph1 T A 1: 17,091,391 N349I possibly damaging Het
Klrg1 A G 6: 122,282,735 L26P probably benign Het
M1ap A C 6: 83,003,832 D233A probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mycbp2 A G 14: 103,156,510 S2762P probably benign Het
Myh11 T A 16: 14,205,625 Q1556L probably damaging Het
N4bp2 A G 5: 65,814,780 D1428G probably damaging Het
Ndc80 A C 17: 71,508,765 C342G probably benign Het
Olfr1057 A G 2: 86,374,890 I174T probably damaging Het
Olfr371 C T 8: 85,231,206 A237V probably benign Het
Olfr776 T A 10: 129,261,838 N292K probably benign Het
Pacs1 A G 19: 5,142,271 F691L probably benign Het
Pcdhga12 T C 18: 37,766,811 V232A probably benign Het
Pik3cb A T 9: 99,054,060 M773K probably damaging Het
Plxnb1 T C 9: 109,114,655 Y1937H probably damaging Het
Ppfia2 C A 10: 106,857,443 T603N probably benign Het
Psg22 A G 7: 18,719,737 Y119C probably damaging Het
Saraf G T 8: 34,161,258 R86L probably damaging Het
Sh3bgrl2 T C 9: 83,548,489 S11P possibly damaging Het
Slc39a4 C T 15: 76,614,083 D385N probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stpg3 T C 2: 25,214,564 N13S probably damaging Het
Taf1a T A 1: 183,395,935 D50E possibly damaging Het
Tlr1 T A 5: 64,925,681 N518Y probably damaging Het
Tnik G A 3: 28,665,844 probably null Het
Tomm70a T A 16: 57,122,151 L97Q probably benign Het
Vmn2r97 T A 17: 18,947,911 V809E probably damaging Het
Vps13d T C 4: 145,156,282 I914V probably benign Het
Zfyve26 A T 12: 79,286,323 H291Q probably damaging Het
Zmynd15 G T 11: 70,462,561 C334F probably damaging Het
Other mutations in Nxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Nxn APN 11 76274655 splice site probably benign
IGL01780:Nxn APN 11 76274654 splice site probably benign
IGL02350:Nxn APN 11 76274654 splice site probably benign
IGL02357:Nxn APN 11 76274654 splice site probably benign
IGL02423:Nxn APN 11 76274032 missense probably benign 0.13
R0098:Nxn UTSW 11 76278594 splice site probably benign
R0456:Nxn UTSW 11 76263137 nonsense probably null
R1127:Nxn UTSW 11 76274069 nonsense probably null
R1473:Nxn UTSW 11 76263187 missense possibly damaging 0.93
R1681:Nxn UTSW 11 76272464 missense probably benign 0.03
R1917:Nxn UTSW 11 76261672 splice site probably benign
R1918:Nxn UTSW 11 76261672 splice site probably benign
R2010:Nxn UTSW 11 76398801 missense probably damaging 0.99
R4501:Nxn UTSW 11 76274612 missense probably damaging 0.98
R4827:Nxn UTSW 11 76261592 missense probably benign 0.01
R5078:Nxn UTSW 11 76261607 missense probably damaging 1.00
R6403:Nxn UTSW 11 76399020 missense probably benign 0.22
R7088:Nxn UTSW 11 76263148 missense possibly damaging 0.94
R7478:Nxn UTSW 11 76261552 missense probably damaging 0.97
R7642:Nxn UTSW 11 76272459 missense probably damaging 1.00
R7830:Nxn UTSW 11 76273993 missense probably damaging 1.00
X0062:Nxn UTSW 11 76263152 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GGCAGCATGAGCATTTACTG -3'
(R):5'- TGTGCCTGAGCTCATAAGTTC -3'

Sequencing Primer
(F):5'- GGCAGCATGAGCATTTACTGTCATC -3'
(R):5'- ACAATTGTGCCTAGAGTTCTGGAGAC -3'
Posted On2016-06-06