Incidental Mutation 'R5029:Ank'
ID 391580
Institutional Source Beutler Lab
Gene Symbol Ank
Ensembl Gene ENSMUSG00000022265
Gene Name progressive ankylosis
Synonyms D15Ertd221e
MMRRC Submission 042620-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock # R5029 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 27466677-27594909 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27590353 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 341 (V341A)
Ref Sequence ENSEMBL: ENSMUSP00000022875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022875] [ENSMUST00000228179]
AlphaFold Q9JHZ2
Predicted Effect probably benign
Transcript: ENSMUST00000022875
AA Change: V341A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022875
Gene: ENSMUSG00000022265
AA Change: V341A

DomainStartEndE-ValueType
Pfam:ANKH 1 345 1e-223 PFAM
transmembrane domain 361 383 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134004
Predicted Effect probably benign
Transcript: ENSMUST00000228179
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass transmembrane protein that is expressed in joints and other tissues and controls pyrophosphate levels in cultured cells. Progressive ankylosis-mediated control of pyrophosphate levels has been suggested as a possible mechanism regulating tissue calcification and susceptibility to arthritis in higher animals. Mutations in this gene have been associated with autosomal dominant craniometaphyseal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals exhibit joint stiffness due to increased calcium deposits in calcified cartilages and die prematurely. Hyperostosis of craniofacial bones and the mandible has been reported in other mutants as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Bnip3 T A 7: 138,898,119 probably benign Het
C1galt1 A G 6: 7,863,931 K4E possibly damaging Het
Cbs T A 17: 31,615,482 Q511L possibly damaging Het
Ccdc117 T C 11: 5,534,897 H109R possibly damaging Het
Cdh4 T A 2: 179,881,949 V440D possibly damaging Het
Cnot4 T C 6: 35,078,027 N109S probably damaging Het
Dact2 A T 17: 14,195,852 S695R probably benign Het
Defa21 A T 8: 21,026,365 E75V probably damaging Het
Dimt1 A G 13: 106,957,122 D274G probably null Het
Dstyk G T 1: 132,449,324 V223L probably benign Het
Dync1h1 T A 12: 110,618,010 S616T possibly damaging Het
Fer1l6 A T 15: 58,643,920 I1619F probably benign Het
Gm4744 T A 6: 40,949,407 Y83F probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hpx T G 7: 105,591,764 Y434S probably damaging Het
Ints4 A G 7: 97,509,774 D451G probably benign Het
Itgb4 A T 11: 115,988,591 probably benign Het
Jph1 T A 1: 17,091,391 N349I possibly damaging Het
Klrg1 A G 6: 122,282,735 L26P probably benign Het
M1ap A C 6: 83,003,832 D233A probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mycbp2 A G 14: 103,156,510 S2762P probably benign Het
Myh11 T A 16: 14,205,625 Q1556L probably damaging Het
N4bp2 A G 5: 65,814,780 D1428G probably damaging Het
Ndc80 A C 17: 71,508,765 C342G probably benign Het
Nxn A C 11: 76,274,530 Y199* probably null Het
Olfr1057 A G 2: 86,374,890 I174T probably damaging Het
Olfr371 C T 8: 85,231,206 A237V probably benign Het
Olfr776 T A 10: 129,261,838 N292K probably benign Het
Pacs1 A G 19: 5,142,271 F691L probably benign Het
Pcdhga12 T C 18: 37,766,811 V232A probably benign Het
Pik3cb A T 9: 99,054,060 M773K probably damaging Het
Plxnb1 T C 9: 109,114,655 Y1937H probably damaging Het
Ppfia2 C A 10: 106,857,443 T603N probably benign Het
Psg22 A G 7: 18,719,737 Y119C probably damaging Het
Saraf G T 8: 34,161,258 R86L probably damaging Het
Sh3bgrl2 T C 9: 83,548,489 S11P possibly damaging Het
Slc39a4 C T 15: 76,614,083 D385N probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stpg3 T C 2: 25,214,564 N13S probably damaging Het
Taf1a T A 1: 183,395,935 D50E possibly damaging Het
Tlr1 T A 5: 64,925,681 N518Y probably damaging Het
Tnik G A 3: 28,665,844 probably null Het
Tomm70a T A 16: 57,122,151 L97Q probably benign Het
Vmn2r97 T A 17: 18,947,911 V809E probably damaging Het
Vps13d T C 4: 145,156,282 I914V probably benign Het
Zfyve26 A T 12: 79,286,323 H291Q probably damaging Het
Zmynd15 G T 11: 70,462,561 C334F probably damaging Het
Other mutations in Ank
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Ank APN 15 27544351 missense possibly damaging 0.53
IGL02975:Ank APN 15 27467001 utr 5 prime probably benign
R0309:Ank UTSW 15 27567572 missense possibly damaging 0.65
R0470:Ank UTSW 15 27571635 missense probably damaging 0.98
R1688:Ank UTSW 15 27557234 missense probably damaging 1.00
R1691:Ank UTSW 15 27590944 missense probably damaging 1.00
R2073:Ank UTSW 15 27565022 missense probably benign 0.20
R2248:Ank UTSW 15 27562711 splice site probably null
R3113:Ank UTSW 15 27571614 missense probably damaging 1.00
R4027:Ank UTSW 15 27544257 missense probably damaging 1.00
R4028:Ank UTSW 15 27544257 missense probably damaging 1.00
R4029:Ank UTSW 15 27544257 missense probably damaging 1.00
R4030:Ank UTSW 15 27544257 missense probably damaging 1.00
R4124:Ank UTSW 15 27571623 missense probably damaging 1.00
R4126:Ank UTSW 15 27590373 missense probably benign
R4508:Ank UTSW 15 27564977 missense probably damaging 1.00
R4517:Ank UTSW 15 27562749 missense possibly damaging 0.51
R4631:Ank UTSW 15 27467090 missense probably benign
R4653:Ank UTSW 15 27590361 missense probably null 0.98
R5001:Ank UTSW 15 27562733 missense probably damaging 0.99
R5475:Ank UTSW 15 27557199 missense probably damaging 1.00
R7218:Ank UTSW 15 27544321 missense probably damaging 1.00
R7234:Ank UTSW 15 27571656 critical splice donor site probably null
R8530:Ank UTSW 15 27544404 missense probably benign
R8859:Ank UTSW 15 27562748 missense possibly damaging 0.93
R8935:Ank UTSW 15 27591026 missense probably damaging 0.99
R9002:Ank UTSW 15 27544327 nonsense probably null
R9408:Ank UTSW 15 27591502 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCACACGGATAGATGCCAC -3'
(R):5'- CCTCACTCTTAGGCATTGGTG -3'

Sequencing Primer
(F):5'- GGATAGATGCCACCCACAGTC -3'
(R):5'- GGTGCCACTGCTCATTCTGTATG -3'
Posted On 2016-06-06