Incidental Mutation 'R5029:Slc39a4'
ID391582
Institutional Source Beutler Lab
Gene Symbol Slc39a4
Ensembl Gene ENSMUSG00000063354
Gene Namesolute carrier family 39 (zinc transporter), member 4
SynonymsAWMS2, zip4, 1600025H15Rik
MMRRC Submission 042620-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5029 (G1)
Quality Score187
Status Validated
Chromosome15
Chromosomal Location76612383-76617384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76614083 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 385 (D385N)
Ref Sequence ENSEMBL: ENSMUSP00000155442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073428] [ENSMUST00000230977]
Predicted Effect probably damaging
Transcript: ENSMUST00000073428
AA Change: D385N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073134
Gene: ENSMUSG00000063354
AA Change: D385N

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
Pfam:Zip 335 652 3.5e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230317
Predicted Effect probably damaging
Transcript: ENSMUST00000230977
AA Change: D385N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5181 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc/iron-regulated transporter-like protein (ZIP) family. The encoded protein localizes to cell membranes and is required for zinc uptake in the intestine. Mutations in this gene result in acrodermatitis enteropathica. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic letahlity around E10. Mice heterozygous for a null allele exhibit developmental defects similar to the teratology of zinc deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Ank T C 15: 27,590,353 V341A probably benign Het
Bnip3 T A 7: 138,898,119 probably benign Het
C1galt1 A G 6: 7,863,931 K4E possibly damaging Het
Cbs T A 17: 31,615,482 Q511L possibly damaging Het
Ccdc117 T C 11: 5,534,897 H109R possibly damaging Het
Cdh4 T A 2: 179,881,949 V440D possibly damaging Het
Cnot4 T C 6: 35,078,027 N109S probably damaging Het
Dact2 A T 17: 14,195,852 S695R probably benign Het
Defa21 A T 8: 21,026,365 E75V probably damaging Het
Dimt1 A G 13: 106,957,122 D274G probably null Het
Dstyk G T 1: 132,449,324 V223L probably benign Het
Dync1h1 T A 12: 110,618,010 S616T possibly damaging Het
Fer1l6 A T 15: 58,643,920 I1619F probably benign Het
Gm4744 T A 6: 40,949,407 Y83F probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hpx T G 7: 105,591,764 Y434S probably damaging Het
Ints4 A G 7: 97,509,774 D451G probably benign Het
Itgb4 A T 11: 115,988,591 probably benign Het
Jph1 T A 1: 17,091,391 N349I possibly damaging Het
Klrg1 A G 6: 122,282,735 L26P probably benign Het
M1ap A C 6: 83,003,832 D233A probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mycbp2 A G 14: 103,156,510 S2762P probably benign Het
Myh11 T A 16: 14,205,625 Q1556L probably damaging Het
N4bp2 A G 5: 65,814,780 D1428G probably damaging Het
Ndc80 A C 17: 71,508,765 C342G probably benign Het
Nxn A C 11: 76,274,530 Y199* probably null Het
Olfr1057 A G 2: 86,374,890 I174T probably damaging Het
Olfr371 C T 8: 85,231,206 A237V probably benign Het
Olfr776 T A 10: 129,261,838 N292K probably benign Het
Pacs1 A G 19: 5,142,271 F691L probably benign Het
Pcdhga12 T C 18: 37,766,811 V232A probably benign Het
Pik3cb A T 9: 99,054,060 M773K probably damaging Het
Plxnb1 T C 9: 109,114,655 Y1937H probably damaging Het
Ppfia2 C A 10: 106,857,443 T603N probably benign Het
Psg22 A G 7: 18,719,737 Y119C probably damaging Het
Saraf G T 8: 34,161,258 R86L probably damaging Het
Sh3bgrl2 T C 9: 83,548,489 S11P possibly damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stpg3 T C 2: 25,214,564 N13S probably damaging Het
Taf1a T A 1: 183,395,935 D50E possibly damaging Het
Tlr1 T A 5: 64,925,681 N518Y probably damaging Het
Tnik G A 3: 28,665,844 probably null Het
Tomm70a T A 16: 57,122,151 L97Q probably benign Het
Vmn2r97 T A 17: 18,947,911 V809E probably damaging Het
Vps13d T C 4: 145,156,282 I914V probably benign Het
Zfyve26 A T 12: 79,286,323 H291Q probably damaging Het
Zmynd15 G T 11: 70,462,561 C334F probably damaging Het
Other mutations in Slc39a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Slc39a4 APN 15 76614203 missense probably damaging 1.00
IGL02597:Slc39a4 APN 15 76613624 missense probably benign
IGL02798:Slc39a4 APN 15 76615182 missense probably benign 0.04
texline UTSW 15 76614083 missense probably damaging 1.00
R0519:Slc39a4 UTSW 15 76615138 missense probably benign 0.38
R0815:Slc39a4 UTSW 15 76612639 missense probably damaging 1.00
R1502:Slc39a4 UTSW 15 76616593 missense probably benign 0.00
R1547:Slc39a4 UTSW 15 76614147 nonsense probably null
R2919:Slc39a4 UTSW 15 76616670 missense probably damaging 1.00
R4634:Slc39a4 UTSW 15 76614493 missense probably benign
R5030:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R5669:Slc39a4 UTSW 15 76614163 missense probably damaging 1.00
R6020:Slc39a4 UTSW 15 76616142 missense probably benign 0.03
R6741:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R6920:Slc39a4 UTSW 15 76613270 missense probably damaging 0.99
R7072:Slc39a4 UTSW 15 76613258 missense probably damaging 1.00
RF035:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF039:Slc39a4 UTSW 15 76614870 small insertion probably benign
RF039:Slc39a4 UTSW 15 76614871 small insertion probably benign
RF040:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF041:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF042:Slc39a4 UTSW 15 76614871 small insertion probably benign
RF043:Slc39a4 UTSW 15 76614870 small insertion probably benign
RF044:Slc39a4 UTSW 15 76614870 small insertion probably benign
Z1176:Slc39a4 UTSW 15 76614173 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTAGAAGCCTCCAAGTACAGC -3'
(R):5'- TCAGTGTAGACTCACCCACAG -3'

Sequencing Primer
(F):5'- CCTCCTCATGGGTGTGACC -3'
(R):5'- CACAGGGTATCTCTATGGCTCG -3'
Posted On2016-06-06