Mutagenetix > Incidental Mutation

Incidental Mutation 'R5030:Gpd2'

391598

Institutional Source

Beutler Lab

Gene Symbol

Gpd2

Ensembl Gene

ENSMUSG00000026827

Gene Name

glycerol phosphate dehydrogenase 2, mitochondrial

Synonyms

Gdm1

MMRRC Submission

042621-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.476) question?

Stock #

R5030 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57237635-57370719 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57304405 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 107 (T107A)

Ref Sequence

ENSEMBL: ENSMUSP00000130992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000169687]

AlphaFold

Q64521

Predicted Effect

probably damaging
Transcript: ENSMUST00000028167
AA Change: T107A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827
AA Change: T107A

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112618
AA Change: T107A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827
AA Change: T107A

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	143	4.6e-7	PFAM
Pfam:DAO	71	441	2.9e-50	PFAM
Pfam:DAO_C	462	588	2.1e-42	PFAM
EFh	645	673	1.38e1	SMART
EFh	681	709	1.27e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141536

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148991

Predicted Effect

probably damaging
Transcript: ENSMUST00000169687
AA Change: T107A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827
AA Change: T107A

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Meta Mutation Damage Score

0.7440

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

98% (87/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930584F24Rik	A	C	5: 26,479,785		noncoding transcript	Het
4932438A13Rik	A	G	3: 36,943,399		probably benign	Het
9330182L06Rik	T	A	5: 9,428,502	N455K	probably damaging	Het
Abca15	A	T	7: 120,340,001	E206V	probably damaging	Het
Acy1	A	G	9: 106,433,397	F343L	probably benign	Het
Adam22	T	C	5: 8,179,645		probably benign	Het
Adgrv1	A	T	13: 81,459,829	D4041E	probably benign	Het
Akr1c14	T	C	13: 4,079,102	S166P	probably damaging	Het
Alms1	T	A	6: 85,627,964	C2199S	probably damaging	Het
Atm	A	T	9: 53,520,109	Y316*	probably null	Het
Atp1a1	T	C	3: 101,579,817	D892G	probably benign	Het
Auts2	A	G	5: 131,443,498	V581A	probably benign	Het
Boll	T	A	1: 55,355,735	N57I	probably damaging	Het
C1s2	A	C	6: 124,635,588	V36G	possibly damaging	Het
Capza1	T	C	3: 104,840,838	Y70C	probably damaging	Het
Carnmt1	T	C	19: 18,691,586	S292P	possibly damaging	Het
Cyp2g1	T	G	7: 26,820,801	V486G	probably benign	Het
Dennd6b	T	A	15: 89,196,251	T49S	possibly damaging	Het
Dhx58	A	T	11: 100,696,137	I610N	probably damaging	Het
Fam170a	T	A	18: 50,281,954	N222K	probably benign	Het
Fbn1	A	G	2: 125,412,704	V213A	possibly damaging	Het
Frem3	A	C	8: 80,613,247	D723A	possibly damaging	Het
Fsip2	A	T	2: 82,988,492	K4856N	possibly damaging	Het
Galnt17	A	G	5: 130,876,513	V571A	probably damaging	Het
Gm6124	A	G	7: 39,223,030		noncoding transcript	Het
Gm884	G	A	11: 103,534,849	P1419S	unknown	Het
Gm8973	A	G	15: 99,006,255		noncoding transcript	Het
Hsd17b11	G	A	5: 104,003,292	A192V	probably damaging	Het
Igkv6-25	C	T	6: 70,215,442	Q4*	probably null	Het
Kalrn	A	G	16: 33,975,742	I1221T	probably benign	Het
Klhl9	G	T	4: 88,720,534	T490K	possibly damaging	Het
Lnpep	A	G	17: 17,579,309	V28A	probably damaging	Het
Man2c1	A	G	9: 57,140,639	H843R	probably benign	Het
Map1b	T	C	13: 99,434,174	K680E	unknown	Het
Metap2	A	T	10: 93,879,677		probably null	Het
Mfsd2a	A	T	4: 122,950,156	I340N	possibly damaging	Het
Mgll	T	C	6: 88,818,665		probably null	Het
Mum1	T	C	10: 80,240,375		probably benign	Het
Myh9	A	G	15: 77,807,798		probably benign	Het
Ncapd3	A	T	9: 27,071,766	I937F	probably damaging	Het
Neb	T	C	2: 52,334,492		probably benign	Het
Nova1	A	G	12: 46,700,247	S416P	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1395	A	T	11: 49,148,361	M35L	probably benign	Het
Olfr502	T	A	7: 108,523,177	I258F	possibly damaging	Het
Olfr869	A	T	9: 20,138,067	K317M	probably benign	Het
Oosp3	T	C	19: 11,700,944	W95R	probably benign	Het
Pcdha7	T	A	18: 36,975,448	S509T	probably damaging	Het
Pdgfrb	T	C	18: 61,065,135	V296A	probably benign	Het
Pdzd2	A	T	15: 12,592,408	L50*	probably null	Het
Plcl2	G	T	17: 50,607,319	R452L	possibly damaging	Het
Poldip3	A	T	15: 83,138,191	F131I	possibly damaging	Het
Rffl	G	A	11: 82,812,717	R127*	probably null	Het
Sec24d	T	A	3: 123,358,901	V854E	probably damaging	Het
Sgo2a	T	A	1: 58,017,759	L1034*	probably null	Het
Slc39a4	C	T	15: 76,614,083	D385N	probably damaging	Het
Spaca1	A	T	4: 34,039,247	N95K	possibly damaging	Het
Spag17	C	T	3: 100,085,341	Q1718*	probably null	Het
Spdl1	C	T	11: 34,823,440	A141T	probably benign	Het
Stxbp3-ps	A	T	19: 9,558,350		noncoding transcript	Het
Supv3l1	G	T	10: 62,430,615	A594D	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tcrg-V7	G	T	13: 19,178,388	L82F	probably damaging	Het
Tmem131	T	C	1: 36,827,174	N483S	possibly damaging	Het
Tmem2	T	G	19: 21,842,105	F1087V	probably benign	Het
Tonsl	A	T	15: 76,638,101	C231S	probably damaging	Het
Trav9n-4	T	C	14: 53,294,848	F53S	possibly damaging	Het
Trim45	T	G	3: 100,928,072	V457G	probably damaging	Het
Trpm1	T	A	7: 64,235,831	I865N	probably damaging	Het
Trpm3	C	A	19: 22,698,766	L99I	probably benign	Het
Twist1	T	A	12: 33,958,441	L155Q	probably damaging	Het
Vac14	A	G	8: 110,710,386	E577G	possibly damaging	Het
Vmn1r184	T	C	7: 26,267,456	V209A	probably benign	Het
Xdh	C	T	17: 73,891,293	G1200R	probably damaging	Het
Zbbx	C	T	3: 75,083,683	D290N	possibly damaging	Het
Zbtb40	T	C	4: 136,997,952	T585A	probably benign	Het
Zc3h4	T	A	7: 16,422,230	D262E	unknown	Het
Zfp777	G	T	6: 48,037,667	D368E	probably damaging	Het

Other mutations in Gpd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Gpd2	APN	2	57268084	critical splice donor site	probably null
IGL01012:Gpd2	APN	2	57364530	missense	probably benign	0.00
IGL01096:Gpd2	APN	2	57338867	missense	probably damaging	0.98
IGL01642:Gpd2	APN	2	57268071	nonsense	probably null
IGL01816:Gpd2	APN	2	57364066	nonsense	probably null
IGL02257:Gpd2	APN	2	57364524	missense	probably benign	0.01
IGL02824:Gpd2	APN	2	57364327	missense	probably null	0.89
IGL02832:Gpd2	APN	2	57338979	missense	probably damaging	1.00
IGL03040:Gpd2	APN	2	57355793	missense	probably benign	0.06
IGL03107:Gpd2	APN	2	57355569	missense	probably damaging	1.00
IGL03131:Gpd2	APN	2	57338843	splice site	probably benign
IGL03218:Gpd2	APN	2	57307054	missense	probably damaging	1.00
IGL03226:Gpd2	APN	2	57304486	critical splice donor site	probably null
IGL03372:Gpd2	APN	2	57355507	missense	probably damaging	1.00
R0012:Gpd2	UTSW	2	57338868	missense	probably damaging	1.00
R0285:Gpd2	UTSW	2	57338955	missense	probably benign	0.16
R0379:Gpd2	UTSW	2	57345263	missense	probably damaging	1.00
R0401:Gpd2	UTSW	2	57340093	missense	possibly damaging	0.94
R1347:Gpd2	UTSW	2	57357671	missense	probably damaging	0.99
R1347:Gpd2	UTSW	2	57357671	missense	probably damaging	0.99
R1468:Gpd2	UTSW	2	57355774	missense	probably damaging	1.00
R1468:Gpd2	UTSW	2	57355774	missense	probably damaging	1.00
R1490:Gpd2	UTSW	2	57355475	missense	probably damaging	1.00
R1672:Gpd2	UTSW	2	57357700	missense	probably damaging	0.97
R1709:Gpd2	UTSW	2	57357655	missense	probably damaging	1.00
R1735:Gpd2	UTSW	2	57355551	missense	probably damaging	1.00
R2056:Gpd2	UTSW	2	57339013	critical splice donor site	probably null
R2959:Gpd2	UTSW	2	57338975	nonsense	probably null
R2960:Gpd2	UTSW	2	57338975	nonsense	probably null
R2961:Gpd2	UTSW	2	57338975	nonsense	probably null
R2962:Gpd2	UTSW	2	57338975	nonsense	probably null
R3008:Gpd2	UTSW	2	57338975	nonsense	probably null
R3009:Gpd2	UTSW	2	57338975	nonsense	probably null
R3881:Gpd2	UTSW	2	57338975	nonsense	probably null
R4073:Gpd2	UTSW	2	57290013	missense	probably damaging	1.00
R4153:Gpd2	UTSW	2	57355771	missense	probably damaging	1.00
R4564:Gpd2	UTSW	2	57307083	missense	possibly damaging	0.77
R4952:Gpd2	UTSW	2	57307013	nonsense	probably null
R5101:Gpd2	UTSW	2	57355901	missense	probably damaging	1.00
R5185:Gpd2	UTSW	2	57340204	missense	probably damaging	1.00
R6020:Gpd2	UTSW	2	57364513	missense	probably benign	0.18
R6325:Gpd2	UTSW	2	57304396	missense	probably damaging	0.96
R6536:Gpd2	UTSW	2	57345355	missense	probably benign	0.40
R6923:Gpd2	UTSW	2	57355788	missense	probably damaging	0.98
R7058:Gpd2	UTSW	2	57307100	splice site	probably null
R7380:Gpd2	UTSW	2	57340159	missense	probably damaging	1.00
R8052:Gpd2	UTSW	2	57306950	nonsense	probably null
R8098:Gpd2	UTSW	2	57290008	missense	possibly damaging	0.94
R8467:Gpd2	UTSW	2	57364584	missense	possibly damaging	0.95
R8851:Gpd2	UTSW	2	57307050	missense	possibly damaging	0.62
R9515:Gpd2	UTSW	2	57305854	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- ACTTGTCCCTCAGGAAGAGC -3'
(R):5'- TCCTGAAAGATGCTCCAAGC -3'

Sequencing Primer
(F):5'- TGTCTCTACCCTGGAGAA -3'
(R):5'- TGATAGCCTTCTGGAGGTA -3'

Posted On

2016-06-06