Incidental Mutation 'R5030:Atp1a1'
ID 391605
Institutional Source Beutler Lab
Gene Symbol Atp1a1
Ensembl Gene ENSMUSG00000033161
Gene Name ATPase, Na+/K+ transporting, alpha 1 polypeptide
Synonyms Atpa-1
MMRRC Submission 042621-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5030 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 101576219-101604684 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101579817 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 892 (D892G)
Ref Sequence ENSEMBL: ENSMUSP00000039657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036493]
AlphaFold Q8VDN2
Predicted Effect probably benign
Transcript: ENSMUST00000036493
AA Change: D892G

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: D892G

DomainStartEndE-ValueType
low complexity region 21 28 N/A INTRINSIC
Cation_ATPase_N 42 116 5e-20 SMART
Pfam:E1-E2_ATPase 134 365 1.6e-59 PFAM
Pfam:Hydrolase 370 729 2.7e-19 PFAM
Pfam:HAD 373 726 1.3e-18 PFAM
Pfam:Cation_ATPase 426 521 2.2e-25 PFAM
Pfam:Cation_ATPase_C 799 1008 1.2e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197360
Meta Mutation Damage Score 0.0938 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A C 5: 26,479,785 noncoding transcript Het
4932438A13Rik A G 3: 36,943,399 probably benign Het
9330182L06Rik T A 5: 9,428,502 N455K probably damaging Het
Abca15 A T 7: 120,340,001 E206V probably damaging Het
Acy1 A G 9: 106,433,397 F343L probably benign Het
Adam22 T C 5: 8,179,645 probably benign Het
Adgrv1 A T 13: 81,459,829 D4041E probably benign Het
Akr1c14 T C 13: 4,079,102 S166P probably damaging Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Atm A T 9: 53,520,109 Y316* probably null Het
Auts2 A G 5: 131,443,498 V581A probably benign Het
Boll T A 1: 55,355,735 N57I probably damaging Het
C1s2 A C 6: 124,635,588 V36G possibly damaging Het
Capza1 T C 3: 104,840,838 Y70C probably damaging Het
Carnmt1 T C 19: 18,691,586 S292P possibly damaging Het
Cyp2g1 T G 7: 26,820,801 V486G probably benign Het
Dennd6b T A 15: 89,196,251 T49S possibly damaging Het
Dhx58 A T 11: 100,696,137 I610N probably damaging Het
Fam170a T A 18: 50,281,954 N222K probably benign Het
Fbn1 A G 2: 125,412,704 V213A possibly damaging Het
Frem3 A C 8: 80,613,247 D723A possibly damaging Het
Fsip2 A T 2: 82,988,492 K4856N possibly damaging Het
Galnt17 A G 5: 130,876,513 V571A probably damaging Het
Gm6124 A G 7: 39,223,030 noncoding transcript Het
Gm884 G A 11: 103,534,849 P1419S unknown Het
Gm8973 A G 15: 99,006,255 noncoding transcript Het
Gpd2 A G 2: 57,304,405 T107A probably damaging Het
Hsd17b11 G A 5: 104,003,292 A192V probably damaging Het
Igkv6-25 C T 6: 70,215,442 Q4* probably null Het
Kalrn A G 16: 33,975,742 I1221T probably benign Het
Klhl9 G T 4: 88,720,534 T490K possibly damaging Het
Lnpep A G 17: 17,579,309 V28A probably damaging Het
Man2c1 A G 9: 57,140,639 H843R probably benign Het
Map1b T C 13: 99,434,174 K680E unknown Het
Metap2 A T 10: 93,879,677 probably null Het
Mfsd2a A T 4: 122,950,156 I340N possibly damaging Het
Mgll T C 6: 88,818,665 probably null Het
Mum1 T C 10: 80,240,375 probably benign Het
Myh9 A G 15: 77,807,798 probably benign Het
Ncapd3 A T 9: 27,071,766 I937F probably damaging Het
Neb T C 2: 52,334,492 probably benign Het
Nova1 A G 12: 46,700,247 S416P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1395 A T 11: 49,148,361 M35L probably benign Het
Olfr502 T A 7: 108,523,177 I258F possibly damaging Het
Olfr869 A T 9: 20,138,067 K317M probably benign Het
Oosp3 T C 19: 11,700,944 W95R probably benign Het
Pcdha7 T A 18: 36,975,448 S509T probably damaging Het
Pdgfrb T C 18: 61,065,135 V296A probably benign Het
Pdzd2 A T 15: 12,592,408 L50* probably null Het
Plcl2 G T 17: 50,607,319 R452L possibly damaging Het
Poldip3 A T 15: 83,138,191 F131I possibly damaging Het
Rffl G A 11: 82,812,717 R127* probably null Het
Sec24d T A 3: 123,358,901 V854E probably damaging Het
Sgo2a T A 1: 58,017,759 L1034* probably null Het
Slc39a4 C T 15: 76,614,083 D385N probably damaging Het
Spaca1 A T 4: 34,039,247 N95K possibly damaging Het
Spag17 C T 3: 100,085,341 Q1718* probably null Het
Spdl1 C T 11: 34,823,440 A141T probably benign Het
Stxbp3-ps A T 19: 9,558,350 noncoding transcript Het
Supv3l1 G T 10: 62,430,615 A594D probably damaging Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tcrg-V7 G T 13: 19,178,388 L82F probably damaging Het
Tmem131 T C 1: 36,827,174 N483S possibly damaging Het
Tmem2 T G 19: 21,842,105 F1087V probably benign Het
Tonsl A T 15: 76,638,101 C231S probably damaging Het
Trav9n-4 T C 14: 53,294,848 F53S possibly damaging Het
Trim45 T G 3: 100,928,072 V457G probably damaging Het
Trpm1 T A 7: 64,235,831 I865N probably damaging Het
Trpm3 C A 19: 22,698,766 L99I probably benign Het
Twist1 T A 12: 33,958,441 L155Q probably damaging Het
Vac14 A G 8: 110,710,386 E577G possibly damaging Het
Vmn1r184 T C 7: 26,267,456 V209A probably benign Het
Xdh C T 17: 73,891,293 G1200R probably damaging Het
Zbbx C T 3: 75,083,683 D290N possibly damaging Het
Zbtb40 T C 4: 136,997,952 T585A probably benign Het
Zc3h4 T A 7: 16,422,230 D262E unknown Het
Zfp777 G T 6: 48,037,667 D368E probably damaging Het
Other mutations in Atp1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Atp1a1 APN 3 101591453 missense probably damaging 1.00
IGL01700:Atp1a1 APN 3 101594258 missense possibly damaging 0.95
IGL01836:Atp1a1 APN 3 101591414 missense probably damaging 1.00
IGL01863:Atp1a1 APN 3 101591889 nonsense probably null
IGL02021:Atp1a1 APN 3 101594208 missense probably benign 0.02
IGL02078:Atp1a1 APN 3 101591863 missense probably damaging 1.00
IGL02873:Atp1a1 APN 3 101576578 missense probably benign 0.16
IGL02934:Atp1a1 APN 3 101576992 nonsense probably null
IGL03068:Atp1a1 APN 3 101583859 missense probably benign 0.26
PIT4453001:Atp1a1 UTSW 3 101581179 missense probably benign 0.01
R0009:Atp1a1 UTSW 3 101579835 missense possibly damaging 0.67
R0506:Atp1a1 UTSW 3 101589812 missense probably damaging 0.96
R0724:Atp1a1 UTSW 3 101592439 missense possibly damaging 0.50
R0826:Atp1a1 UTSW 3 101584853 missense probably damaging 0.99
R1457:Atp1a1 UTSW 3 101590466 missense probably damaging 1.00
R1732:Atp1a1 UTSW 3 101584799 missense probably damaging 1.00
R1843:Atp1a1 UTSW 3 101582017 missense probably benign 0.43
R2172:Atp1a1 UTSW 3 101590548 missense probably benign
R3770:Atp1a1 UTSW 3 101581194 missense probably benign 0.17
R3905:Atp1a1 UTSW 3 101590612 missense probably benign 0.00
R4602:Atp1a1 UTSW 3 101586943 missense probably benign 0.00
R4611:Atp1a1 UTSW 3 101586943 missense probably benign 0.00
R4715:Atp1a1 UTSW 3 101591806 missense possibly damaging 0.90
R4777:Atp1a1 UTSW 3 101594996 critical splice donor site probably null
R4795:Atp1a1 UTSW 3 101583775 missense probably benign 0.15
R5066:Atp1a1 UTSW 3 101582104 missense probably damaging 0.98
R5165:Atp1a1 UTSW 3 101581789 missense probably benign 0.01
R5297:Atp1a1 UTSW 3 101591127 missense possibly damaging 0.82
R5307:Atp1a1 UTSW 3 101589964 missense probably damaging 1.00
R5379:Atp1a1 UTSW 3 101582095 missense probably benign 0.01
R5495:Atp1a1 UTSW 3 101591425 missense probably benign 0.01
R5946:Atp1a1 UTSW 3 101589774 missense probably benign 0.12
R6125:Atp1a1 UTSW 3 101590707 missense probably damaging 1.00
R6789:Atp1a1 UTSW 3 101586298 missense possibly damaging 0.71
R7339:Atp1a1 UTSW 3 101589872 missense probably benign 0.44
R7552:Atp1a1 UTSW 3 101582121 nonsense probably null
R7825:Atp1a1 UTSW 3 101586169 missense probably benign 0.00
R8098:Atp1a1 UTSW 3 101582049 missense probably damaging 0.97
R8175:Atp1a1 UTSW 3 101584854 missense possibly damaging 0.79
R8281:Atp1a1 UTSW 3 101579624 missense probably benign 0.12
R8403:Atp1a1 UTSW 3 101586904 missense probably damaging 1.00
R8435:Atp1a1 UTSW 3 101582762 missense probably benign
R8461:Atp1a1 UTSW 3 101589089 missense probably benign 0.01
R8772:Atp1a1 UTSW 3 101579808 missense probably benign
R8782:Atp1a1 UTSW 3 101594217 missense possibly damaging 0.63
R8919:Atp1a1 UTSW 3 101591231 missense probably damaging 1.00
R9066:Atp1a1 UTSW 3 101582022 missense probably damaging 1.00
R9227:Atp1a1 UTSW 3 101592434 missense probably damaging 1.00
R9712:Atp1a1 UTSW 3 101591441 missense probably benign 0.06
X0019:Atp1a1 UTSW 3 101594213 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCTCGTAGGTCTGAAAGGG -3'
(R):5'- AGTTGGTGATCCAGAATGGG -3'

Sequencing Primer
(F):5'- CTCGTAGGTCTGAAAGGGGAAGC -3'
(R):5'- AGAACTCTCTGGGGCTGCTG -3'
Posted On 2016-06-06