Incidental Mutation 'R5030:Tcaf3'
ID 391616
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 042621-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R5030 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42573867 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 115 (V115A)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably benign
Transcript: ENSMUST00000069023
AA Change: V115A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: V115A

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
AA Change: V115A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656
AA Change: V115A

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (87/89)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A C 5: 26,684,783 (GRCm39) noncoding transcript Het
Abca15 A T 7: 119,939,224 (GRCm39) E206V probably damaging Het
Acy1 A G 9: 106,310,596 (GRCm39) F343L probably benign Het
Adam22 T C 5: 8,229,645 (GRCm39) probably benign Het
Adgrv1 A T 13: 81,607,948 (GRCm39) D4041E probably benign Het
Akr1c14 T C 13: 4,129,102 (GRCm39) S166P probably damaging Het
Alms1 T A 6: 85,604,946 (GRCm39) C2199S probably damaging Het
Atm A T 9: 53,431,409 (GRCm39) Y316* probably null Het
Atp1a1 T C 3: 101,487,133 (GRCm39) D892G probably benign Het
Auts2 A G 5: 131,472,336 (GRCm39) V581A probably benign Het
Bltp1 A G 3: 36,997,548 (GRCm39) probably benign Het
Boll T A 1: 55,394,894 (GRCm39) N57I probably damaging Het
C1s2 A C 6: 124,612,547 (GRCm39) V36G possibly damaging Het
Capza1 T C 3: 104,748,154 (GRCm39) Y70C probably damaging Het
Carnmt1 T C 19: 18,668,950 (GRCm39) S292P possibly damaging Het
Cemip2 T G 19: 21,819,469 (GRCm39) F1087V probably benign Het
Cyp2g1 T G 7: 26,520,226 (GRCm39) V486G probably benign Het
Dennd6b T A 15: 89,080,454 (GRCm39) T49S possibly damaging Het
Dhx58 A T 11: 100,586,963 (GRCm39) I610N probably damaging Het
Elapor2 T A 5: 9,478,502 (GRCm39) N455K probably damaging Het
Fam170a T A 18: 50,415,021 (GRCm39) N222K probably benign Het
Fbn1 A G 2: 125,254,624 (GRCm39) V213A possibly damaging Het
Frem3 A C 8: 81,339,876 (GRCm39) D723A possibly damaging Het
Fsip2 A T 2: 82,818,836 (GRCm39) K4856N possibly damaging Het
Galnt17 A G 5: 130,905,351 (GRCm39) V571A probably damaging Het
Gm6124 A G 7: 38,872,454 (GRCm39) noncoding transcript Het
Gm8973 A G 15: 98,904,136 (GRCm39) noncoding transcript Het
Gpd2 A G 2: 57,194,417 (GRCm39) T107A probably damaging Het
Hsd17b11 G A 5: 104,151,158 (GRCm39) A192V probably damaging Het
Igkv6-25 C T 6: 70,192,426 (GRCm39) Q4* probably null Het
Kalrn A G 16: 33,796,112 (GRCm39) I1221T probably benign Het
Klhl9 G T 4: 88,638,771 (GRCm39) T490K possibly damaging Het
Lnpep A G 17: 17,799,571 (GRCm39) V28A probably damaging Het
Lrrc37 G A 11: 103,425,675 (GRCm39) P1419S unknown Het
Man2c1 A G 9: 57,047,923 (GRCm39) H843R probably benign Het
Map1b T C 13: 99,570,682 (GRCm39) K680E unknown Het
Metap2 A T 10: 93,715,539 (GRCm39) probably null Het
Mfsd2a A T 4: 122,843,949 (GRCm39) I340N possibly damaging Het
Mgll T C 6: 88,795,647 (GRCm39) probably null Het
Myh9 A G 15: 77,691,998 (GRCm39) probably benign Het
Ncapd3 A T 9: 26,983,062 (GRCm39) I937F probably damaging Het
Neb T C 2: 52,224,504 (GRCm39) probably benign Het
Nova1 A G 12: 46,747,030 (GRCm39) S416P probably damaging Het
Oosp3 T C 19: 11,678,308 (GRCm39) W95R probably benign Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2t26 A T 11: 49,039,188 (GRCm39) M35L probably benign Het
Or5p76 T A 7: 108,122,384 (GRCm39) I258F possibly damaging Het
Or7e175 A T 9: 20,049,363 (GRCm39) K317M probably benign Het
Pcdha7 T A 18: 37,108,501 (GRCm39) S509T probably damaging Het
Pdgfrb T C 18: 61,198,207 (GRCm39) V296A probably benign Het
Pdzd2 A T 15: 12,592,494 (GRCm39) L50* probably null Het
Plcl2 G T 17: 50,914,347 (GRCm39) R452L possibly damaging Het
Poldip3 A T 15: 83,022,392 (GRCm39) F131I possibly damaging Het
Pwwp3a T C 10: 80,076,209 (GRCm39) probably benign Het
Rffl G A 11: 82,703,543 (GRCm39) R127* probably null Het
Sec24d T A 3: 123,152,550 (GRCm39) V854E probably damaging Het
Sgo2a T A 1: 58,056,918 (GRCm39) L1034* probably null Het
Slc39a4 C T 15: 76,498,283 (GRCm39) D385N probably damaging Het
Spaca1 A T 4: 34,039,247 (GRCm39) N95K possibly damaging Het
Spag17 C T 3: 99,992,657 (GRCm39) Q1718* probably null Het
Spdl1 C T 11: 34,714,267 (GRCm39) A141T probably benign Het
Stxbp3-ps A T 19: 9,535,714 (GRCm39) noncoding transcript Het
Supv3l1 G T 10: 62,266,394 (GRCm39) A594D probably damaging Het
Tmem131 T C 1: 36,866,255 (GRCm39) N483S possibly damaging Het
Tonsl A T 15: 76,522,301 (GRCm39) C231S probably damaging Het
Trav9n-4 T C 14: 53,532,305 (GRCm39) F53S possibly damaging Het
Trgv7 G T 13: 19,362,558 (GRCm39) L82F probably damaging Het
Trim45 T G 3: 100,835,388 (GRCm39) V457G probably damaging Het
Trpm1 T A 7: 63,885,579 (GRCm39) I865N probably damaging Het
Trpm3 C A 19: 22,676,130 (GRCm39) L99I probably benign Het
Twist1 T A 12: 34,008,440 (GRCm39) L155Q probably damaging Het
Vac14 A G 8: 111,437,018 (GRCm39) E577G possibly damaging Het
Vmn1r184 T C 7: 25,966,881 (GRCm39) V209A probably benign Het
Xdh C T 17: 74,198,288 (GRCm39) G1200R probably damaging Het
Zbbx C T 3: 74,990,990 (GRCm39) D290N possibly damaging Het
Zbtb40 T C 4: 136,725,263 (GRCm39) T585A probably benign Het
Zc3h4 T A 7: 16,156,155 (GRCm39) D262E unknown Het
Zfp777 G T 6: 48,014,601 (GRCm39) D368E probably damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42,570,486 (GRCm39) missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42,568,364 (GRCm39) missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42,564,513 (GRCm39) missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42,573,954 (GRCm39) missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42,570,649 (GRCm39) missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42,568,401 (GRCm39) missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42,573,697 (GRCm39) missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42,564,462 (GRCm39) missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42,574,105 (GRCm39) missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42,574,059 (GRCm39) missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42,570,825 (GRCm39) missense probably benign
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42,566,848 (GRCm39) missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R7909:Tcaf3 UTSW 6 42,568,898 (GRCm39) missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9469:Tcaf3 UTSW 6 42,573,828 (GRCm39) missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACCAGTCTCTATTCGCAGAG -3'
(R):5'- TCTTCCTATGGACAAGGCCG -3'

Sequencing Primer
(F):5'- AGCCACACTTGTCACCTGG -3'
(R):5'- GCCTGGTGGTCGTATCCCATG -3'
Posted On 2016-06-06