Mutagenetix > Incidental Mutation

Incidental Mutation 'R5030:Trpm1'

391625

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

042621-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5030 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 64235831 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 865 (I865N)

Ref Sequence

ENSEMBL: ENSMUSP00000082318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314]

AlphaFold

Q2TV84

Predicted Effect

probably damaging
Transcript: ENSMUST00000085222
AA Change: I865N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: I865N

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000107519
AA Change: I749N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103143
Gene: ENSMUSG00000030523
AA Change: I749N

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
low complexity region	505	534	N/A	INTRINSIC
low complexity region	707	719	N/A	INTRINSIC
transmembrane domain	760	779	N/A	INTRINSIC
Pfam:Ion_trans	791	1004	1.3e-15	PFAM
transmembrane domain	1034	1051	N/A	INTRINSIC
low complexity region	1100	1109	N/A	INTRINSIC
PDB:3E7K\|H	1112	1163	1e-7	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205939

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206000

Predicted Effect

probably damaging
Transcript: ENSMUST00000206263
AA Change: I749N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206277
AA Change: I865N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Meta Mutation Damage Score

0.5297

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

98% (87/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930584F24Rik	A	C	5: 26,479,785		noncoding transcript	Het
4932438A13Rik	A	G	3: 36,943,399		probably benign	Het
9330182L06Rik	T	A	5: 9,428,502	N455K	probably damaging	Het
Abca15	A	T	7: 120,340,001	E206V	probably damaging	Het
Acy1	A	G	9: 106,433,397	F343L	probably benign	Het
Adam22	T	C	5: 8,179,645		probably benign	Het
Adgrv1	A	T	13: 81,459,829	D4041E	probably benign	Het
Akr1c14	T	C	13: 4,079,102	S166P	probably damaging	Het
Alms1	T	A	6: 85,627,964	C2199S	probably damaging	Het
Atm	A	T	9: 53,520,109	Y316*	probably null	Het
Atp1a1	T	C	3: 101,579,817	D892G	probably benign	Het
Auts2	A	G	5: 131,443,498	V581A	probably benign	Het
Boll	T	A	1: 55,355,735	N57I	probably damaging	Het
C1s2	A	C	6: 124,635,588	V36G	possibly damaging	Het
Capza1	T	C	3: 104,840,838	Y70C	probably damaging	Het
Carnmt1	T	C	19: 18,691,586	S292P	possibly damaging	Het
Cyp2g1	T	G	7: 26,820,801	V486G	probably benign	Het
Dennd6b	T	A	15: 89,196,251	T49S	possibly damaging	Het
Dhx58	A	T	11: 100,696,137	I610N	probably damaging	Het
Fam170a	T	A	18: 50,281,954	N222K	probably benign	Het
Fbn1	A	G	2: 125,412,704	V213A	possibly damaging	Het
Frem3	A	C	8: 80,613,247	D723A	possibly damaging	Het
Fsip2	A	T	2: 82,988,492	K4856N	possibly damaging	Het
Galnt17	A	G	5: 130,876,513	V571A	probably damaging	Het
Gm6124	A	G	7: 39,223,030		noncoding transcript	Het
Gm884	G	A	11: 103,534,849	P1419S	unknown	Het
Gm8973	A	G	15: 99,006,255		noncoding transcript	Het
Gpd2	A	G	2: 57,304,405	T107A	probably damaging	Het
Hsd17b11	G	A	5: 104,003,292	A192V	probably damaging	Het
Igkv6-25	C	T	6: 70,215,442	Q4*	probably null	Het
Kalrn	A	G	16: 33,975,742	I1221T	probably benign	Het
Klhl9	G	T	4: 88,720,534	T490K	possibly damaging	Het
Lnpep	A	G	17: 17,579,309	V28A	probably damaging	Het
Man2c1	A	G	9: 57,140,639	H843R	probably benign	Het
Map1b	T	C	13: 99,434,174	K680E	unknown	Het
Metap2	A	T	10: 93,879,677		probably null	Het
Mfsd2a	A	T	4: 122,950,156	I340N	possibly damaging	Het
Mgll	T	C	6: 88,818,665		probably null	Het
Mum1	T	C	10: 80,240,375		probably benign	Het
Myh9	A	G	15: 77,807,798		probably benign	Het
Ncapd3	A	T	9: 27,071,766	I937F	probably damaging	Het
Neb	T	C	2: 52,334,492		probably benign	Het
Nova1	A	G	12: 46,700,247	S416P	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1395	A	T	11: 49,148,361	M35L	probably benign	Het
Olfr502	T	A	7: 108,523,177	I258F	possibly damaging	Het
Olfr869	A	T	9: 20,138,067	K317M	probably benign	Het
Oosp3	T	C	19: 11,700,944	W95R	probably benign	Het
Pcdha7	T	A	18: 36,975,448	S509T	probably damaging	Het
Pdgfrb	T	C	18: 61,065,135	V296A	probably benign	Het
Pdzd2	A	T	15: 12,592,408	L50*	probably null	Het
Plcl2	G	T	17: 50,607,319	R452L	possibly damaging	Het
Poldip3	A	T	15: 83,138,191	F131I	possibly damaging	Het
Rffl	G	A	11: 82,812,717	R127*	probably null	Het
Sec24d	T	A	3: 123,358,901	V854E	probably damaging	Het
Sgo2a	T	A	1: 58,017,759	L1034*	probably null	Het
Slc39a4	C	T	15: 76,614,083	D385N	probably damaging	Het
Spaca1	A	T	4: 34,039,247	N95K	possibly damaging	Het
Spag17	C	T	3: 100,085,341	Q1718*	probably null	Het
Spdl1	C	T	11: 34,823,440	A141T	probably benign	Het
Stxbp3-ps	A	T	19: 9,558,350		noncoding transcript	Het
Supv3l1	G	T	10: 62,430,615	A594D	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tcrg-V7	G	T	13: 19,178,388	L82F	probably damaging	Het
Tmem131	T	C	1: 36,827,174	N483S	possibly damaging	Het
Tmem2	T	G	19: 21,842,105	F1087V	probably benign	Het
Tonsl	A	T	15: 76,638,101	C231S	probably damaging	Het
Trav9n-4	T	C	14: 53,294,848	F53S	possibly damaging	Het
Trim45	T	G	3: 100,928,072	V457G	probably damaging	Het
Trpm3	C	A	19: 22,698,766	L99I	probably benign	Het
Twist1	T	A	12: 33,958,441	L155Q	probably damaging	Het
Vac14	A	G	8: 110,710,386	E577G	possibly damaging	Het
Vmn1r184	T	C	7: 26,267,456	V209A	probably benign	Het
Xdh	C	T	17: 73,891,293	G1200R	probably damaging	Het
Zbbx	C	T	3: 75,083,683	D290N	possibly damaging	Het
Zbtb40	T	C	4: 136,997,952	T585A	probably benign	Het
Zc3h4	T	A	7: 16,422,230	D262E	unknown	Het
Zfp777	G	T	6: 48,037,667	D368E	probably damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGTTGGAGATGGCCTAGTCC -3'
(R):5'- GCTATTTTGCTTCAGGAAATCATGG -3'

Sequencing Primer
(F):5'- AGATGGCCTAGTCCCACCTGTAG -3'
(R):5'- GGCCTCGGATAGCCAATAC -3'

Posted On

2016-06-06