Incidental Mutation 'R5030:Trpm1'
ID 391625
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, melastatin, 4732499L03Rik, LTRPC1
MMRRC Submission 042621-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5030 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 63803583-63919523 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63885579 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 865 (I865N)
Ref Sequence ENSEMBL: ENSMUSP00000082318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314]
AlphaFold Q2TV84
Predicted Effect probably damaging
Transcript: ENSMUST00000085222
AA Change: I865N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: I865N

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107519
AA Change: I749N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103143
Gene: ENSMUSG00000030523
AA Change: I749N

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
low complexity region 173 191 N/A INTRINSIC
low complexity region 340 375 N/A INTRINSIC
low complexity region 505 534 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
transmembrane domain 760 779 N/A INTRINSIC
Pfam:Ion_trans 791 1004 1.3e-15 PFAM
transmembrane domain 1034 1051 N/A INTRINSIC
low complexity region 1100 1109 N/A INTRINSIC
PDB:3E7K|H 1112 1163 1e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206000
Predicted Effect probably damaging
Transcript: ENSMUST00000206263
AA Change: I749N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000206277
AA Change: I865N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Meta Mutation Damage Score 0.5297 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A C 5: 26,684,783 (GRCm39) noncoding transcript Het
Abca15 A T 7: 119,939,224 (GRCm39) E206V probably damaging Het
Acy1 A G 9: 106,310,596 (GRCm39) F343L probably benign Het
Adam22 T C 5: 8,229,645 (GRCm39) probably benign Het
Adgrv1 A T 13: 81,607,948 (GRCm39) D4041E probably benign Het
Akr1c14 T C 13: 4,129,102 (GRCm39) S166P probably damaging Het
Alms1 T A 6: 85,604,946 (GRCm39) C2199S probably damaging Het
Atm A T 9: 53,431,409 (GRCm39) Y316* probably null Het
Atp1a1 T C 3: 101,487,133 (GRCm39) D892G probably benign Het
Auts2 A G 5: 131,472,336 (GRCm39) V581A probably benign Het
Bltp1 A G 3: 36,997,548 (GRCm39) probably benign Het
Boll T A 1: 55,394,894 (GRCm39) N57I probably damaging Het
C1s2 A C 6: 124,612,547 (GRCm39) V36G possibly damaging Het
Capza1 T C 3: 104,748,154 (GRCm39) Y70C probably damaging Het
Carnmt1 T C 19: 18,668,950 (GRCm39) S292P possibly damaging Het
Cemip2 T G 19: 21,819,469 (GRCm39) F1087V probably benign Het
Cyp2g1 T G 7: 26,520,226 (GRCm39) V486G probably benign Het
Dennd6b T A 15: 89,080,454 (GRCm39) T49S possibly damaging Het
Dhx58 A T 11: 100,586,963 (GRCm39) I610N probably damaging Het
Elapor2 T A 5: 9,478,502 (GRCm39) N455K probably damaging Het
Fam170a T A 18: 50,415,021 (GRCm39) N222K probably benign Het
Fbn1 A G 2: 125,254,624 (GRCm39) V213A possibly damaging Het
Frem3 A C 8: 81,339,876 (GRCm39) D723A possibly damaging Het
Fsip2 A T 2: 82,818,836 (GRCm39) K4856N possibly damaging Het
Galnt17 A G 5: 130,905,351 (GRCm39) V571A probably damaging Het
Gm6124 A G 7: 38,872,454 (GRCm39) noncoding transcript Het
Gm8973 A G 15: 98,904,136 (GRCm39) noncoding transcript Het
Gpd2 A G 2: 57,194,417 (GRCm39) T107A probably damaging Het
Hsd17b11 G A 5: 104,151,158 (GRCm39) A192V probably damaging Het
Igkv6-25 C T 6: 70,192,426 (GRCm39) Q4* probably null Het
Kalrn A G 16: 33,796,112 (GRCm39) I1221T probably benign Het
Klhl9 G T 4: 88,638,771 (GRCm39) T490K possibly damaging Het
Lnpep A G 17: 17,799,571 (GRCm39) V28A probably damaging Het
Lrrc37 G A 11: 103,425,675 (GRCm39) P1419S unknown Het
Man2c1 A G 9: 57,047,923 (GRCm39) H843R probably benign Het
Map1b T C 13: 99,570,682 (GRCm39) K680E unknown Het
Metap2 A T 10: 93,715,539 (GRCm39) probably null Het
Mfsd2a A T 4: 122,843,949 (GRCm39) I340N possibly damaging Het
Mgll T C 6: 88,795,647 (GRCm39) probably null Het
Myh9 A G 15: 77,691,998 (GRCm39) probably benign Het
Ncapd3 A T 9: 26,983,062 (GRCm39) I937F probably damaging Het
Neb T C 2: 52,224,504 (GRCm39) probably benign Het
Nova1 A G 12: 46,747,030 (GRCm39) S416P probably damaging Het
Oosp3 T C 19: 11,678,308 (GRCm39) W95R probably benign Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2t26 A T 11: 49,039,188 (GRCm39) M35L probably benign Het
Or5p76 T A 7: 108,122,384 (GRCm39) I258F possibly damaging Het
Or7e175 A T 9: 20,049,363 (GRCm39) K317M probably benign Het
Pcdha7 T A 18: 37,108,501 (GRCm39) S509T probably damaging Het
Pdgfrb T C 18: 61,198,207 (GRCm39) V296A probably benign Het
Pdzd2 A T 15: 12,592,494 (GRCm39) L50* probably null Het
Plcl2 G T 17: 50,914,347 (GRCm39) R452L possibly damaging Het
Poldip3 A T 15: 83,022,392 (GRCm39) F131I possibly damaging Het
Pwwp3a T C 10: 80,076,209 (GRCm39) probably benign Het
Rffl G A 11: 82,703,543 (GRCm39) R127* probably null Het
Sec24d T A 3: 123,152,550 (GRCm39) V854E probably damaging Het
Sgo2a T A 1: 58,056,918 (GRCm39) L1034* probably null Het
Slc39a4 C T 15: 76,498,283 (GRCm39) D385N probably damaging Het
Spaca1 A T 4: 34,039,247 (GRCm39) N95K possibly damaging Het
Spag17 C T 3: 99,992,657 (GRCm39) Q1718* probably null Het
Spdl1 C T 11: 34,714,267 (GRCm39) A141T probably benign Het
Stxbp3-ps A T 19: 9,535,714 (GRCm39) noncoding transcript Het
Supv3l1 G T 10: 62,266,394 (GRCm39) A594D probably damaging Het
Tcaf3 A G 6: 42,573,867 (GRCm39) V115A probably benign Het
Tmem131 T C 1: 36,866,255 (GRCm39) N483S possibly damaging Het
Tonsl A T 15: 76,522,301 (GRCm39) C231S probably damaging Het
Trav9n-4 T C 14: 53,532,305 (GRCm39) F53S possibly damaging Het
Trgv7 G T 13: 19,362,558 (GRCm39) L82F probably damaging Het
Trim45 T G 3: 100,835,388 (GRCm39) V457G probably damaging Het
Trpm3 C A 19: 22,676,130 (GRCm39) L99I probably benign Het
Twist1 T A 12: 34,008,440 (GRCm39) L155Q probably damaging Het
Vac14 A G 8: 111,437,018 (GRCm39) E577G possibly damaging Het
Vmn1r184 T C 7: 25,966,881 (GRCm39) V209A probably benign Het
Xdh C T 17: 74,198,288 (GRCm39) G1200R probably damaging Het
Zbbx C T 3: 74,990,990 (GRCm39) D290N possibly damaging Het
Zbtb40 T C 4: 136,725,263 (GRCm39) T585A probably benign Het
Zc3h4 T A 7: 16,156,155 (GRCm39) D262E unknown Het
Zfp777 G T 6: 48,014,601 (GRCm39) D368E probably damaging Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 63,893,198 (GRCm39) missense probably damaging 1.00
IGL00465:Trpm1 APN 7 63,897,215 (GRCm39) missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 63,885,572 (GRCm39) missense probably benign 0.24
IGL01148:Trpm1 APN 7 63,893,312 (GRCm39) missense probably damaging 1.00
IGL01303:Trpm1 APN 7 63,860,578 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 63,884,767 (GRCm39) missense probably benign 0.18
IGL01433:Trpm1 APN 7 63,854,276 (GRCm39) missense probably damaging 1.00
IGL01506:Trpm1 APN 7 63,893,329 (GRCm39) missense probably damaging 1.00
IGL01626:Trpm1 APN 7 63,918,637 (GRCm39) missense probably damaging 1.00
IGL01640:Trpm1 APN 7 63,876,645 (GRCm39) missense probably damaging 1.00
IGL01899:Trpm1 APN 7 63,884,742 (GRCm39) missense probably benign 0.24
IGL01959:Trpm1 APN 7 63,858,723 (GRCm39) missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 63,860,613 (GRCm39) missense probably damaging 1.00
IGL02268:Trpm1 APN 7 63,867,362 (GRCm39) missense probably damaging 0.96
IGL02331:Trpm1 APN 7 63,884,800 (GRCm39) missense probably benign 0.30
IGL02334:Trpm1 APN 7 63,895,690 (GRCm39) critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 63,868,869 (GRCm39) missense probably damaging 1.00
IGL02425:Trpm1 APN 7 63,890,175 (GRCm39) missense probably damaging 0.96
IGL02485:Trpm1 APN 7 63,918,862 (GRCm39) missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 63,848,972 (GRCm39) missense probably benign 0.00
IGL02640:Trpm1 APN 7 63,868,881 (GRCm39) missense probably damaging 0.97
IGL02827:Trpm1 APN 7 63,868,908 (GRCm39) missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 63,918,309 (GRCm39) missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 63,848,998 (GRCm39) intron probably benign
R0012:Trpm1 UTSW 7 63,918,339 (GRCm39) missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 63,897,970 (GRCm39) missense probably damaging 1.00
R0056:Trpm1 UTSW 7 63,893,334 (GRCm39) missense probably damaging 1.00
R0445:Trpm1 UTSW 7 63,894,590 (GRCm39) unclassified probably benign
R0463:Trpm1 UTSW 7 63,870,002 (GRCm39) missense probably benign 0.05
R0469:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R0510:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R1301:Trpm1 UTSW 7 63,852,801 (GRCm39) splice site probably null
R1397:Trpm1 UTSW 7 63,867,406 (GRCm39) missense probably damaging 1.00
R1588:Trpm1 UTSW 7 63,873,565 (GRCm39) missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 63,890,283 (GRCm39) missense probably damaging 1.00
R1724:Trpm1 UTSW 7 63,885,569 (GRCm39) nonsense probably null
R1827:Trpm1 UTSW 7 63,884,755 (GRCm39) missense probably damaging 1.00
R1829:Trpm1 UTSW 7 63,876,530 (GRCm39) missense probably damaging 1.00
R1835:Trpm1 UTSW 7 63,880,016 (GRCm39) missense probably damaging 1.00
R1864:Trpm1 UTSW 7 63,917,764 (GRCm39) missense probably damaging 1.00
R1895:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1946:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1959:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1960:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1980:Trpm1 UTSW 7 63,858,182 (GRCm39) missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 63,858,780 (GRCm39) intron probably null
R2054:Trpm1 UTSW 7 63,890,303 (GRCm39) missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 63,884,736 (GRCm39) missense probably damaging 1.00
R2251:Trpm1 UTSW 7 63,859,724 (GRCm39) missense probably damaging 1.00
R3051:Trpm1 UTSW 7 63,918,849 (GRCm39) missense probably damaging 1.00
R3148:Trpm1 UTSW 7 63,884,760 (GRCm39) missense probably benign 0.00
R3195:Trpm1 UTSW 7 63,849,061 (GRCm39) nonsense probably null
R3615:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3616:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3623:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3624:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3721:Trpm1 UTSW 7 63,867,475 (GRCm39) intron probably benign
R3822:Trpm1 UTSW 7 63,867,451 (GRCm39) intron probably benign
R4441:Trpm1 UTSW 7 63,851,666 (GRCm39) missense probably damaging 1.00
R4490:Trpm1 UTSW 7 63,858,660 (GRCm39) nonsense probably null
R4666:Trpm1 UTSW 7 63,852,782 (GRCm39) missense probably damaging 1.00
R4701:Trpm1 UTSW 7 63,893,248 (GRCm39) missense probably damaging 1.00
R4781:Trpm1 UTSW 7 63,884,800 (GRCm39) missense probably benign 0.30
R4811:Trpm1 UTSW 7 63,858,054 (GRCm39) missense probably damaging 1.00
R5017:Trpm1 UTSW 7 63,894,580 (GRCm39) unclassified probably benign
R5195:Trpm1 UTSW 7 63,887,441 (GRCm39) missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 63,918,702 (GRCm39) missense probably damaging 1.00
R5304:Trpm1 UTSW 7 63,858,694 (GRCm39) missense probably benign 0.00
R5575:Trpm1 UTSW 7 63,870,018 (GRCm39) missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 63,858,159 (GRCm39) missense probably damaging 1.00
R5855:Trpm1 UTSW 7 63,918,710 (GRCm39) nonsense probably null
R5947:Trpm1 UTSW 7 63,873,547 (GRCm39) missense probably benign 0.07
R5988:Trpm1 UTSW 7 63,876,553 (GRCm39) missense probably benign 0.16
R6054:Trpm1 UTSW 7 63,918,450 (GRCm39) missense probably benign 0.00
R6088:Trpm1 UTSW 7 63,917,724 (GRCm39) missense probably damaging 0.98
R6259:Trpm1 UTSW 7 63,918,226 (GRCm39) missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 63,848,942 (GRCm39) missense probably benign 0.00
R6380:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.24
R6429:Trpm1 UTSW 7 63,918,252 (GRCm39) missense probably benign 0.00
R6600:Trpm1 UTSW 7 63,803,781 (GRCm39) start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 63,890,343 (GRCm39) missense probably damaging 0.96
R6939:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.03
R6944:Trpm1 UTSW 7 63,893,181 (GRCm39) missense probably damaging 1.00
R7025:Trpm1 UTSW 7 63,876,462 (GRCm39) critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 63,885,593 (GRCm39) missense probably damaging 0.97
R7168:Trpm1 UTSW 7 63,918,445 (GRCm39) missense probably benign 0.01
R7219:Trpm1 UTSW 7 63,854,333 (GRCm39) missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 63,868,854 (GRCm39) critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 63,859,729 (GRCm39) nonsense probably null
R7367:Trpm1 UTSW 7 63,918,549 (GRCm39) missense probably benign 0.06
R7449:Trpm1 UTSW 7 63,858,723 (GRCm39) missense probably benign 0.14
R7466:Trpm1 UTSW 7 63,890,330 (GRCm39) missense probably damaging 0.99
R7498:Trpm1 UTSW 7 63,858,657 (GRCm39) missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 63,854,303 (GRCm39) missense probably benign 0.00
R7776:Trpm1 UTSW 7 63,897,939 (GRCm39) missense probably benign 0.04
R8062:Trpm1 UTSW 7 63,851,689 (GRCm39) missense probably benign 0.18
R8069:Trpm1 UTSW 7 63,858,718 (GRCm39) missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 63,849,017 (GRCm39) missense probably damaging 1.00
R8219:Trpm1 UTSW 7 63,851,699 (GRCm39) missense probably benign 0.35
R8258:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8259:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8320:Trpm1 UTSW 7 63,918,541 (GRCm39) missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 63,897,155 (GRCm39) missense probably damaging 1.00
R8544:Trpm1 UTSW 7 63,874,356 (GRCm39) splice site probably null
R8813:Trpm1 UTSW 7 63,851,756 (GRCm39) missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 63,918,628 (GRCm39) missense probably benign 0.06
R8954:Trpm1 UTSW 7 63,858,089 (GRCm39) missense probably damaging 0.98
R9139:Trpm1 UTSW 7 63,848,943 (GRCm39) missense probably benign 0.00
R9205:Trpm1 UTSW 7 63,890,319 (GRCm39) missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 63,884,713 (GRCm39) missense probably benign 0.01
R9283:Trpm1 UTSW 7 63,873,623 (GRCm39) missense probably benign 0.18
R9394:Trpm1 UTSW 7 63,918,480 (GRCm39) missense probably benign 0.00
R9430:Trpm1 UTSW 7 63,873,446 (GRCm39) missense probably benign 0.38
R9537:Trpm1 UTSW 7 63,803,616 (GRCm39) unclassified probably benign
R9616:Trpm1 UTSW 7 63,858,132 (GRCm39) missense probably damaging 0.99
R9774:Trpm1 UTSW 7 63,898,041 (GRCm39) missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 63,918,658 (GRCm39) missense probably benign 0.05
Z1176:Trpm1 UTSW 7 63,854,342 (GRCm39) critical splice donor site probably null
Z1176:Trpm1 UTSW 7 63,852,879 (GRCm39) critical splice donor site probably null
Z1177:Trpm1 UTSW 7 63,867,439 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGTTGGAGATGGCCTAGTCC -3'
(R):5'- GCTATTTTGCTTCAGGAAATCATGG -3'

Sequencing Primer
(F):5'- AGATGGCCTAGTCCCACCTGTAG -3'
(R):5'- GGCCTCGGATAGCCAATAC -3'
Posted On 2016-06-06