Incidental Mutation 'R5030:Olfr1395'
ID391640
Institutional Source Beutler Lab
Gene Symbol Olfr1395
Ensembl Gene ENSMUSG00000050763
Gene Nameolfactory receptor 1395
SynonymsMOR277-1, GA_x6K02T2QP88-6286247-6285294
MMRRC Submission 042621-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5030 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49142274-49150453 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49148361 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 35 (M35L)
Ref Sequence ENSEMBL: ENSMUSP00000150679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059379] [ENSMUST00000203377] [ENSMUST00000214195]
Predicted Effect probably benign
Transcript: ENSMUST00000059379
AA Change: M35L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000050142
Gene: ENSMUSG00000050763
AA Change: M35L

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 252 4.8e-6 PFAM
Pfam:7tm_1 42 291 1.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203377
AA Change: M35L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000145357
Gene: ENSMUSG00000050763
AA Change: M35L

DomainStartEndE-ValueType
Pfam:7tm_1 1 219 1.9e-18 PFAM
Pfam:7tm_4 1 237 2.4e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214195
AA Change: M35L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A C 5: 26,479,785 noncoding transcript Het
4932438A13Rik A G 3: 36,943,399 probably benign Het
9330182L06Rik T A 5: 9,428,502 N455K probably damaging Het
Abca15 A T 7: 120,340,001 E206V probably damaging Het
Acy1 A G 9: 106,433,397 F343L probably benign Het
Adam22 T C 5: 8,179,645 probably benign Het
Adgrv1 A T 13: 81,459,829 D4041E probably benign Het
Akr1c14 T C 13: 4,079,102 S166P probably damaging Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Atm A T 9: 53,520,109 Y316* probably null Het
Atp1a1 T C 3: 101,579,817 D892G probably benign Het
Auts2 A G 5: 131,443,498 V581A probably benign Het
Boll T A 1: 55,355,735 N57I probably damaging Het
C1s2 A C 6: 124,635,588 V36G possibly damaging Het
Capza1 T C 3: 104,840,838 Y70C probably damaging Het
Carnmt1 T C 19: 18,691,586 S292P possibly damaging Het
Cyp2g1 T G 7: 26,820,801 V486G probably benign Het
Dennd6b T A 15: 89,196,251 T49S possibly damaging Het
Dhx58 A T 11: 100,696,137 I610N probably damaging Het
Fam170a T A 18: 50,281,954 N222K probably benign Het
Fbn1 A G 2: 125,412,704 V213A possibly damaging Het
Frem3 A C 8: 80,613,247 D723A possibly damaging Het
Fsip2 A T 2: 82,988,492 K4856N possibly damaging Het
Galnt17 A G 5: 130,876,513 V571A probably damaging Het
Gm6124 A G 7: 39,223,030 noncoding transcript Het
Gm884 G A 11: 103,534,849 P1419S unknown Het
Gm8973 A G 15: 99,006,255 noncoding transcript Het
Gpd2 A G 2: 57,304,405 T107A probably damaging Het
Hsd17b11 G A 5: 104,003,292 A192V probably damaging Het
Igkv6-25 C T 6: 70,215,442 Q4* probably null Het
Kalrn A G 16: 33,975,742 I1221T probably benign Het
Klhl9 G T 4: 88,720,534 T490K possibly damaging Het
Lnpep A G 17: 17,579,309 V28A probably damaging Het
Man2c1 A G 9: 57,140,639 H843R probably benign Het
Map1b T C 13: 99,434,174 K680E unknown Het
Metap2 A T 10: 93,879,677 probably null Het
Mfsd2a A T 4: 122,950,156 I340N possibly damaging Het
Mgll T C 6: 88,818,665 probably null Het
Mum1 T C 10: 80,240,375 probably benign Het
Myh9 A G 15: 77,807,798 probably benign Het
Ncapd3 A T 9: 27,071,766 I937F probably damaging Het
Neb T C 2: 52,334,492 probably benign Het
Nova1 A G 12: 46,700,247 S416P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr502 T A 7: 108,523,177 I258F possibly damaging Het
Olfr869 A T 9: 20,138,067 K317M probably benign Het
Oosp3 T C 19: 11,700,944 W95R probably benign Het
Pcdha7 T A 18: 36,975,448 S509T probably damaging Het
Pdgfrb T C 18: 61,065,135 V296A probably benign Het
Pdzd2 A T 15: 12,592,408 L50* probably null Het
Plcl2 G T 17: 50,607,319 R452L possibly damaging Het
Poldip3 A T 15: 83,138,191 F131I possibly damaging Het
Rffl G A 11: 82,812,717 R127* probably null Het
Sec24d T A 3: 123,358,901 V854E probably damaging Het
Sgo2a T A 1: 58,017,759 L1034* probably null Het
Slc39a4 C T 15: 76,614,083 D385N probably damaging Het
Spaca1 A T 4: 34,039,247 N95K possibly damaging Het
Spag17 C T 3: 100,085,341 Q1718* probably null Het
Spdl1 C T 11: 34,823,440 A141T probably benign Het
Stxbp3-ps A T 19: 9,558,350 noncoding transcript Het
Supv3l1 G T 10: 62,430,615 A594D probably damaging Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tcrg-V7 G T 13: 19,178,388 L82F probably damaging Het
Tmem131 T C 1: 36,827,174 N483S possibly damaging Het
Tmem2 T G 19: 21,842,105 F1087V probably benign Het
Tonsl A T 15: 76,638,101 C231S probably damaging Het
Trav9n-4 T C 14: 53,294,848 F53S possibly damaging Het
Trim45 T G 3: 100,928,072 V457G probably damaging Het
Trpm1 T A 7: 64,235,831 I865N probably damaging Het
Trpm3 C A 19: 22,698,766 L99I probably benign Het
Twist1 T A 12: 33,958,441 L155Q probably damaging Het
Vac14 A G 8: 110,710,386 E577G possibly damaging Het
Vmn1r184 T C 7: 26,267,456 V209A probably benign Het
Xdh C T 17: 73,891,293 G1200R probably damaging Het
Zbbx C T 3: 75,083,683 D290N possibly damaging Het
Zbtb40 T C 4: 136,997,952 T585A probably benign Het
Zc3h4 T A 7: 16,422,230 D262E unknown Het
Zfp777 G T 6: 48,037,667 D368E probably damaging Het
Other mutations in Olfr1395
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02413:Olfr1395 APN 11 49148557 missense probably damaging 1.00
IGL02946:Olfr1395 APN 11 49148892 missense probably damaging 1.00
R0030:Olfr1395 UTSW 11 49149040 missense possibly damaging 0.81
R1013:Olfr1395 UTSW 11 49149150 missense probably damaging 1.00
R1577:Olfr1395 UTSW 11 49149189 missense probably benign 0.05
R1908:Olfr1395 UTSW 11 49148274 missense possibly damaging 0.95
R3715:Olfr1395 UTSW 11 49148815 missense probably damaging 0.99
R4386:Olfr1395 UTSW 11 49149015 missense probably damaging 1.00
R4496:Olfr1395 UTSW 11 49148387 missense possibly damaging 0.86
R6044:Olfr1395 UTSW 11 49148695 missense probably benign 0.29
R6226:Olfr1395 UTSW 11 49148833 missense possibly damaging 0.81
R7177:Olfr1395 UTSW 11 49149185 nonsense probably null
R7282:Olfr1395 UTSW 11 49149118 missense probably damaging 1.00
R7391:Olfr1395 UTSW 11 49148979 missense probably damaging 1.00
R7411:Olfr1395 UTSW 11 49148994 missense probably benign 0.01
R7888:Olfr1395 UTSW 11 49148439 missense probably damaging 1.00
R7971:Olfr1395 UTSW 11 49148439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACATTGGACAAAGTCACAGTATC -3'
(R):5'- GAAGAGAATCTGGAGCCCAC -3'

Sequencing Primer
(F):5'- AACCTGCTTCCAGATCCC -3'
(R):5'- ATCTGGAGCCCACAGCCAG -3'
Posted On2016-06-06