Mutagenetix > Incidental Mutations

Incidental Mutation 'R5030:Olfr1'

391641

Institutional Source

Beutler Lab

Gene Symbol

Olfr1

Ensembl Gene

ENSMUSG00000069823

Gene Name

olfactory receptor 1

Synonyms

I54, MOR135-13, GA_x6K02T2P1NL-3556334-3555390

MMRRC Submission

042621-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R5030 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

73393010-73399614 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

AGCGGTCGTAGGC to AGC at 73395654 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]

Predicted Effect

probably null
Transcript: ENSMUST00000120303

SMART Domains

Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	8.7e-60	PFAM
Pfam:7tm_1	41	290	2e-27	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000131253

SMART Domains

Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	31	184	1.2e-6	PFAM
Pfam:7TM_GPCR_Srsx	35	171	6.1e-8	PFAM
Pfam:7tm_1	41	191	3.6e-30	PFAM
Pfam:7tm_4	139	196	1.4e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134011

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

98% (87/89)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930584F24Rik	A	C	5: 26,479,785		noncoding transcript	Het
4932438A13Rik	A	G	3: 36,943,399		probably benign	Het
9330182L06Rik	T	A	5: 9,428,502	N455K	probably damaging	Het
Abca15	A	T	7: 120,340,001	E206V	probably damaging	Het
Acy1	A	G	9: 106,433,397	F343L	probably benign	Het
Adam22	T	C	5: 8,179,645		probably benign	Het
Adgrv1	A	T	13: 81,459,829	D4041E	probably benign	Het
Akr1c14	T	C	13: 4,079,102	S166P	probably damaging	Het
Alms1	T	A	6: 85,627,964	C2199S	probably damaging	Het
Atm	A	T	9: 53,520,109	Y316*	probably null	Het
Atp1a1	T	C	3: 101,579,817	D892G	probably benign	Het
Auts2	A	G	5: 131,443,498	V581A	probably benign	Het
Boll	T	A	1: 55,355,735	N57I	probably damaging	Het
C1s2	A	C	6: 124,635,588	V36G	possibly damaging	Het
Capza1	T	C	3: 104,840,838	Y70C	probably damaging	Het
Carnmt1	T	C	19: 18,691,586	S292P	possibly damaging	Het
Cyp2g1	T	G	7: 26,820,801	V486G	probably benign	Het
Dennd6b	T	A	15: 89,196,251	T49S	possibly damaging	Het
Dhx58	A	T	11: 100,696,137	I610N	probably damaging	Het
Fam170a	T	A	18: 50,281,954	N222K	probably benign	Het
Fbn1	A	G	2: 125,412,704	V213A	possibly damaging	Het
Frem3	A	C	8: 80,613,247	D723A	possibly damaging	Het
Fsip2	A	T	2: 82,988,492	K4856N	possibly damaging	Het
Galnt17	A	G	5: 130,876,513	V571A	probably damaging	Het
Gm6124	A	G	7: 39,223,030		noncoding transcript	Het
Gm884	G	A	11: 103,534,849	P1419S	unknown	Het
Gm8973	A	G	15: 99,006,255		noncoding transcript	Het
Gpd2	A	G	2: 57,304,405	T107A	probably damaging	Het
Hsd17b11	G	A	5: 104,003,292	A192V	probably damaging	Het
Igkv6-25	C	T	6: 70,215,442	Q4*	probably null	Het
Kalrn	A	G	16: 33,975,742	I1221T	probably benign	Het
Klhl9	G	T	4: 88,720,534	T490K	possibly damaging	Het
Lnpep	A	G	17: 17,579,309	V28A	probably damaging	Het
Man2c1	A	G	9: 57,140,639	H843R	probably benign	Het
Map1b	T	C	13: 99,434,174	K680E	unknown	Het
Metap2	A	T	10: 93,879,677		probably null	Het
Mfsd2a	A	T	4: 122,950,156	I340N	possibly damaging	Het
Mgll	T	C	6: 88,818,665		probably null	Het
Mum1	T	C	10: 80,240,375		probably benign	Het
Myh9	A	G	15: 77,807,798		probably benign	Het
Ncapd3	A	T	9: 27,071,766	I937F	probably damaging	Het
Neb	T	C	2: 52,334,492		probably benign	Het
Nova1	A	G	12: 46,700,247	S416P	probably damaging	Het
Olfr1395	A	T	11: 49,148,361	M35L	probably benign	Het
Olfr502	T	A	7: 108,523,177	I258F	possibly damaging	Het
Olfr869	A	T	9: 20,138,067	K317M	probably benign	Het
Oosp3	T	C	19: 11,700,944	W95R	probably benign	Het
Pcdha7	T	A	18: 36,975,448	S509T	probably damaging	Het
Pdgfrb	T	C	18: 61,065,135	V296A	probably benign	Het
Pdzd2	A	T	15: 12,592,408	L50*	probably null	Het
Plcl2	G	T	17: 50,607,319	R452L	possibly damaging	Het
Poldip3	A	T	15: 83,138,191	F131I	possibly damaging	Het
Rffl	G	A	11: 82,812,717	R127*	probably null	Het
Sec24d	T	A	3: 123,358,901	V854E	probably damaging	Het
Sgo2a	T	A	1: 58,017,759	L1034*	probably null	Het
Slc39a4	C	T	15: 76,614,083	D385N	probably damaging	Het
Spaca1	A	T	4: 34,039,247	N95K	possibly damaging	Het
Spag17	C	T	3: 100,085,341	Q1718*	probably null	Het
Spdl1	C	T	11: 34,823,440	A141T	probably benign	Het
Stxbp3-ps	A	T	19: 9,558,350		noncoding transcript	Het
Supv3l1	G	T	10: 62,430,615	A594D	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tcrg-V7	G	T	13: 19,178,388	L82F	probably damaging	Het
Tmem131	T	C	1: 36,827,174	N483S	possibly damaging	Het
Tmem2	T	G	19: 21,842,105	F1087V	probably benign	Het
Tonsl	A	T	15: 76,638,101	C231S	probably damaging	Het
Trav9n-4	T	C	14: 53,294,848	F53S	possibly damaging	Het
Trim45	T	G	3: 100,928,072	V457G	probably damaging	Het
Trpm1	T	A	7: 64,235,831	I865N	probably damaging	Het
Trpm3	C	A	19: 22,698,766	L99I	probably benign	Het
Twist1	T	A	12: 33,958,441	L155Q	probably damaging	Het
Vac14	A	G	8: 110,710,386	E577G	possibly damaging	Het
Vmn1r184	T	C	7: 26,267,456	V209A	probably benign	Het
Xdh	C	T	17: 73,891,293	G1200R	probably damaging	Het
Zbbx	C	T	3: 75,083,683	D290N	possibly damaging	Het
Zbtb40	T	C	4: 136,997,952	T585A	probably benign	Het
Zc3h4	T	A	7: 16,422,230	D262E	unknown	Het
Zfp777	G	T	6: 48,037,667	D368E	probably damaging	Het

Other mutations in Olfr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Olfr1	APN	11	73395191	missense	probably damaging	0.98
IGL01938:Olfr1	APN	11	73395645	missense	probably damaging	1.00
IGL02270:Olfr1	APN	11	73395365	missense	probably benign
IGL03287:Olfr1	APN	11	73396019	start codon destroyed	probably null	1.00
R0006:Olfr1	UTSW	11	73395488	missense	probably damaging	0.99
R0907:Olfr1	UTSW	11	73395119	missense	probably damaging	0.97
R1982:Olfr1	UTSW	11	73395092	missense	probably benign	0.00
R3804:Olfr1	UTSW	11	73395950	missense	probably benign	0.01
R4064:Olfr1	UTSW	11	73395522	missense	probably benign	0.04
R4171:Olfr1	UTSW	11	73395539	missense	probably damaging	1.00
R4724:Olfr1	UTSW	11	73395155	missense	probably damaging	1.00
R4732:Olfr1	UTSW	11	73395695	missense	probably benign	0.03
R4733:Olfr1	UTSW	11	73395695	missense	probably benign	0.03
R5097:Olfr1	UTSW	11	73395293	missense	probably damaging	1.00
R5098:Olfr1	UTSW	11	73395654	frame shift	probably null
R5101:Olfr1	UTSW	11	73395654	frame shift	probably null
R5135:Olfr1	UTSW	11	73395654	frame shift	probably null
R5137:Olfr1	UTSW	11	73395654	frame shift	probably null
R5192:Olfr1	UTSW	11	73395654	frame shift	probably null
R5193:Olfr1	UTSW	11	73395653	frame shift	probably null
R5193:Olfr1	UTSW	11	73395654	frame shift	probably null
R5197:Olfr1	UTSW	11	73395654	frame shift	probably null
R5220:Olfr1	UTSW	11	73395654	frame shift	probably null
R5221:Olfr1	UTSW	11	73395654	frame shift	probably null
R5222:Olfr1	UTSW	11	73395654	frame shift	probably null
R5258:Olfr1	UTSW	11	73395654	frame shift	probably null
R5297:Olfr1	UTSW	11	73395654	frame shift	probably null
R5396:Olfr1	UTSW	11	73395654	frame shift	probably null
R5398:Olfr1	UTSW	11	73395654	frame shift	probably null
R5399:Olfr1	UTSW	11	73395654	frame shift	probably null
R5432:Olfr1	UTSW	11	73395654	frame shift	probably null
R5433:Olfr1	UTSW	11	73395654	frame shift	probably null
R5531:Olfr1	UTSW	11	73395177	missense	probably benign	0.26
R5634:Olfr1	UTSW	11	73395654	frame shift	probably null
R5714:Olfr1	UTSW	11	73395361	splice site	probably null
R5812:Olfr1	UTSW	11	73395654	frame shift	probably null
R5813:Olfr1	UTSW	11	73395654	frame shift	probably null
R5814:Olfr1	UTSW	11	73395654	frame shift	probably null
R5815:Olfr1	UTSW	11	73395654	frame shift	probably null
R5913:Olfr1	UTSW	11	73395654	frame shift	probably null
R5955:Olfr1	UTSW	11	73395654	frame shift	probably null
R5956:Olfr1	UTSW	11	73395654	frame shift	probably null
R5968:Olfr1	UTSW	11	73395192	missense	possibly damaging	0.75
R6029:Olfr1	UTSW	11	73395654	frame shift	probably null
R6034:Olfr1	UTSW	11	73395654	frame shift	probably null
R6034:Olfr1	UTSW	11	73395654	frame shift	probably null
R6176:Olfr1	UTSW	11	73395654	frame shift	probably null
R6177:Olfr1	UTSW	11	73395654	frame shift	probably null
R6178:Olfr1	UTSW	11	73395654	frame shift	probably null
R6196:Olfr1	UTSW	11	73395473	missense	probably benign	0.08
R6995:Olfr1	UTSW	11	73395584	missense	probably benign
R7035:Olfr1	UTSW	11	73395718	missense	probably benign	0.00
R7470:Olfr1	UTSW	11	73395888	missense	probably damaging	1.00
R7530:Olfr1	UTSW	11	73388363	missense	possibly damaging	0.55
R8461:Olfr1	UTSW	11	73395156	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTAACACGGGTGTCAGAGCAG -3'
(R):5'- TCCACACACCCATGTACTTG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGCCAGCTTTAG -3'
(R):5'- ATGTACTTGTTTCTCAGCAACTTG -3'

Posted On

2016-06-06