Incidental Mutation 'R5030:Gm884'
ID391644
Institutional Source Beutler Lab
Gene Symbol Gm884
Ensembl Gene ENSMUSG00000034239
Gene Namepredicted gene 884
SynonymsLOC380730
MMRRC Submission 042621-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5030 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103534577-103621140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103534849 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1419 (P1419S)
Ref Sequence ENSEMBL: ENSMUSP00000129662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059279] [ENSMUST00000167262]
Predicted Effect unknown
Transcript: ENSMUST00000059279
AA Change: P3595S
SMART Domains Protein: ENSMUSP00000058511
Gene: ENSMUSG00000034239
AA Change: P3595S

DomainStartEndE-ValueType
Pfam:LRRC37 149 223 5.4e-10 PFAM
low complexity region 244 264 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
Pfam:LRRC37 335 403 1.9e-14 PFAM
Pfam:LRRC37 419 514 1.2e-8 PFAM
Pfam:LRRC37 565 620 2e-10 PFAM
Pfam:LRRC37 669 739 7.6e-18 PFAM
Pfam:LRRC37 741 792 1.6e-9 PFAM
Pfam:LRRC37 789 860 1.4e-23 PFAM
Pfam:LRRC37 861 914 2.8e-9 PFAM
Pfam:LRRC37 911 983 1.9e-23 PFAM
Pfam:LRRC37 979 1038 1e-8 PFAM
Pfam:LRRC37 1034 1105 2.7e-24 PFAM
Pfam:LRRC37 1105 1158 2.3e-9 PFAM
Pfam:LRRC37 1155 1219 2.4e-17 PFAM
Pfam:LRRC37 1222 1265 9.2e-7 PFAM
Pfam:LRRC37 1263 1330 4.9e-24 PFAM
Pfam:LRRC37 1331 1384 1.4e-10 PFAM
Pfam:LRRC37 1380 1451 4.3e-15 PFAM
Pfam:LRRC37 1487 1558 1.9e-15 PFAM
Pfam:LRRC37 1594 1665 2.9e-18 PFAM
Pfam:LRRC37 1701 1772 5.6e-23 PFAM
Pfam:LRRC37 1808 1910 2.8e-18 PFAM
Pfam:LRRC37 1915 1986 7.2e-17 PFAM
Pfam:LRRC37 2022 2093 4.9e-22 PFAM
Pfam:LRRC37 2129 2200 4.4e-22 PFAM
Pfam:LRRC37 2236 2307 2.1e-21 PFAM
Pfam:LRRC37 2343 2414 3.8e-17 PFAM
Pfam:LRRC37 2449 2519 1.6e-19 PFAM
LRR 2777 2796 3.09e1 SMART
LRR_TYP 2797 2820 2.09e-3 SMART
LRR 2821 2844 4.44e0 SMART
LRR 2848 2872 8.26e1 SMART
low complexity region 2991 3002 N/A INTRINSIC
low complexity region 3220 3230 N/A INTRINSIC
low complexity region 3382 3393 N/A INTRINSIC
Pfam:LRRC37AB_C 3424 3570 7.7e-76 PFAM
low complexity region 3571 3589 N/A INTRINSIC
low complexity region 3622 3640 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000167262
AA Change: P1419S
SMART Domains Protein: ENSMUSP00000129662
Gene: ENSMUSG00000034239
AA Change: P1419S

DomainStartEndE-ValueType
internal_repeat_1 1 70 1.46e-11 PROSPERO
internal_repeat_1 108 290 1.46e-11 PROSPERO
LRR 601 620 3.09e1 SMART
LRR_TYP 621 644 2.09e-3 SMART
LRR 645 668 4.44e0 SMART
LRR 672 696 8.26e1 SMART
low complexity region 815 826 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Pfam:LRRC37AB_C 1243 1396 1.2e-92 PFAM
low complexity region 1446 1464 N/A INTRINSIC
Meta Mutation Damage Score 0.2769 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (87/89)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A C 5: 26,479,785 noncoding transcript Het
4932438A13Rik A G 3: 36,943,399 probably benign Het
9330182L06Rik T A 5: 9,428,502 N455K probably damaging Het
Abca15 A T 7: 120,340,001 E206V probably damaging Het
Acy1 A G 9: 106,433,397 F343L probably benign Het
Adam22 T C 5: 8,179,645 probably benign Het
Adgrv1 A T 13: 81,459,829 D4041E probably benign Het
Akr1c14 T C 13: 4,079,102 S166P probably damaging Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Atm A T 9: 53,520,109 Y316* probably null Het
Atp1a1 T C 3: 101,579,817 D892G probably benign Het
Auts2 A G 5: 131,443,498 V581A probably benign Het
Boll T A 1: 55,355,735 N57I probably damaging Het
C1s2 A C 6: 124,635,588 V36G possibly damaging Het
Capza1 T C 3: 104,840,838 Y70C probably damaging Het
Carnmt1 T C 19: 18,691,586 S292P possibly damaging Het
Cyp2g1 T G 7: 26,820,801 V486G probably benign Het
Dennd6b T A 15: 89,196,251 T49S possibly damaging Het
Dhx58 A T 11: 100,696,137 I610N probably damaging Het
Fam170a T A 18: 50,281,954 N222K probably benign Het
Fbn1 A G 2: 125,412,704 V213A possibly damaging Het
Frem3 A C 8: 80,613,247 D723A possibly damaging Het
Fsip2 A T 2: 82,988,492 K4856N possibly damaging Het
Galnt17 A G 5: 130,876,513 V571A probably damaging Het
Gm6124 A G 7: 39,223,030 noncoding transcript Het
Gm8973 A G 15: 99,006,255 noncoding transcript Het
Gpd2 A G 2: 57,304,405 T107A probably damaging Het
Hsd17b11 G A 5: 104,003,292 A192V probably damaging Het
Igkv6-25 C T 6: 70,215,442 Q4* probably null Het
Kalrn A G 16: 33,975,742 I1221T probably benign Het
Klhl9 G T 4: 88,720,534 T490K possibly damaging Het
Lnpep A G 17: 17,579,309 V28A probably damaging Het
Man2c1 A G 9: 57,140,639 H843R probably benign Het
Map1b T C 13: 99,434,174 K680E unknown Het
Metap2 A T 10: 93,879,677 probably null Het
Mfsd2a A T 4: 122,950,156 I340N possibly damaging Het
Mgll T C 6: 88,818,665 probably null Het
Mum1 T C 10: 80,240,375 probably benign Het
Myh9 A G 15: 77,807,798 probably benign Het
Ncapd3 A T 9: 27,071,766 I937F probably damaging Het
Neb T C 2: 52,334,492 probably benign Het
Nova1 A G 12: 46,700,247 S416P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1395 A T 11: 49,148,361 M35L probably benign Het
Olfr502 T A 7: 108,523,177 I258F possibly damaging Het
Olfr869 A T 9: 20,138,067 K317M probably benign Het
Oosp3 T C 19: 11,700,944 W95R probably benign Het
Pcdha7 T A 18: 36,975,448 S509T probably damaging Het
Pdgfrb T C 18: 61,065,135 V296A probably benign Het
Pdzd2 A T 15: 12,592,408 L50* probably null Het
Plcl2 G T 17: 50,607,319 R452L possibly damaging Het
Poldip3 A T 15: 83,138,191 F131I possibly damaging Het
Rffl G A 11: 82,812,717 R127* probably null Het
Sec24d T A 3: 123,358,901 V854E probably damaging Het
Sgo2a T A 1: 58,017,759 L1034* probably null Het
Slc39a4 C T 15: 76,614,083 D385N probably damaging Het
Spaca1 A T 4: 34,039,247 N95K possibly damaging Het
Spag17 C T 3: 100,085,341 Q1718* probably null Het
Spdl1 C T 11: 34,823,440 A141T probably benign Het
Stxbp3-ps A T 19: 9,558,350 noncoding transcript Het
Supv3l1 G T 10: 62,430,615 A594D probably damaging Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tcrg-V7 G T 13: 19,178,388 L82F probably damaging Het
Tmem131 T C 1: 36,827,174 N483S possibly damaging Het
Tmem2 T G 19: 21,842,105 F1087V probably benign Het
Tonsl A T 15: 76,638,101 C231S probably damaging Het
Trav9n-4 T C 14: 53,294,848 F53S possibly damaging Het
Trim45 T G 3: 100,928,072 V457G probably damaging Het
Trpm1 T A 7: 64,235,831 I865N probably damaging Het
Trpm3 C A 19: 22,698,766 L99I probably benign Het
Twist1 T A 12: 33,958,441 L155Q probably damaging Het
Vac14 A G 8: 110,710,386 E577G possibly damaging Het
Vmn1r184 T C 7: 26,267,456 V209A probably benign Het
Xdh C T 17: 73,891,293 G1200R probably damaging Het
Zbbx C T 3: 75,083,683 D290N possibly damaging Het
Zbtb40 T C 4: 136,997,952 T585A probably benign Het
Zc3h4 T A 7: 16,422,230 D262E unknown Het
Zfp777 G T 6: 48,037,667 D368E probably damaging Het
Other mutations in Gm884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Gm884 APN 11 103615410 missense probably benign 0.01
IGL00576:Gm884 APN 11 103617386 unclassified probably benign
IGL00813:Gm884 APN 11 103614498 missense probably benign 0.05
IGL01311:Gm884 APN 11 103534676 missense unknown
IGL01946:Gm884 APN 11 103612933 missense probably benign 0.28
IGL02217:Gm884 APN 11 103612871 splice site probably benign
IGL02556:Gm884 APN 11 103613283 missense probably benign 0.01
IGL02825:Gm884 APN 11 103617068 unclassified probably benign
IGL02868:Gm884 APN 11 103615139 missense probably benign 0.10
IGL02904:Gm884 APN 11 103616361 unclassified probably benign
IGL03008:Gm884 APN 11 103620467 missense unknown
IGL03120:Gm884 APN 11 103616975 unclassified probably benign
IGL03159:Gm884 APN 11 103604502 splice site probably benign
IGL03181:Gm884 APN 11 103616416 unclassified probably benign
IGL03202:Gm884 APN 11 103615373 missense probably benign 0.03
IGL03263:Gm884 APN 11 103613699 missense possibly damaging 0.86
PIT4486001:Gm884 UTSW 11 103618201 missense unknown
R0040:Gm884 UTSW 11 103542990 missense probably damaging 0.99
R0135:Gm884 UTSW 11 103618047 unclassified probably benign
R0141:Gm884 UTSW 11 103613686 missense probably damaging 1.00
R0226:Gm884 UTSW 11 103603241 missense probably benign 0.08
R0547:Gm884 UTSW 11 103620164 missense unknown
R0646:Gm884 UTSW 11 103613160 nonsense probably null
R0685:Gm884 UTSW 11 103616888 unclassified probably benign
R0732:Gm884 UTSW 11 103619838 missense unknown
R1015:Gm884 UTSW 11 103545796 missense probably benign 0.01
R1166:Gm884 UTSW 11 103615383 missense probably benign 0.21
R1168:Gm884 UTSW 11 103618950 unclassified probably benign
R1257:Gm884 UTSW 11 103534641 missense unknown
R1545:Gm884 UTSW 11 103608919 missense probably benign 0.16
R1570:Gm884 UTSW 11 103609938 missense possibly damaging 0.76
R1677:Gm884 UTSW 11 103614942 missense probably benign 0.19
R1703:Gm884 UTSW 11 103540874 missense probably benign 0.39
R1719:Gm884 UTSW 11 103617071 unclassified probably benign
R1752:Gm884 UTSW 11 103614555 missense possibly damaging 0.67
R1870:Gm884 UTSW 11 103620605 missense unknown
R2155:Gm884 UTSW 11 103620459 missense unknown
R2191:Gm884 UTSW 11 103618967 unclassified probably benign
R2271:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R2378:Gm884 UTSW 11 103619711 unclassified probably benign
R2405:Gm884 UTSW 11 103620984 missense unknown
R2864:Gm884 UTSW 11 103540918 missense probably benign 0.34
R3011:Gm884 UTSW 11 103613103 missense possibly damaging 0.62
R3415:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3417:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3835:Gm884 UTSW 11 103620010 missense unknown
R3974:Gm884 UTSW 11 103619101 unclassified probably benign
R4019:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4020:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4176:Gm884 UTSW 11 103536600 missense unknown
R4361:Gm884 UTSW 11 103617501 frame shift probably null
R4418:Gm884 UTSW 11 103618314 unclassified probably benign
R4633:Gm884 UTSW 11 103619131 unclassified probably benign
R4693:Gm884 UTSW 11 103619860 missense unknown
R4758:Gm884 UTSW 11 103614464 missense possibly damaging 0.48
R4878:Gm884 UTSW 11 103617891 unclassified probably benign
R4887:Gm884 UTSW 11 103614872 missense probably benign 0.03
R4944:Gm884 UTSW 11 103613460 missense possibly damaging 0.68
R4952:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R5183:Gm884 UTSW 11 103543121 missense probably damaging 0.99
R5294:Gm884 UTSW 11 103616231 unclassified probably benign
R5317:Gm884 UTSW 11 103614145 missense possibly damaging 0.73
R5334:Gm884 UTSW 11 103613873 missense probably benign 0.18
R5426:Gm884 UTSW 11 103620760 missense unknown
R5467:Gm884 UTSW 11 103603265 nonsense probably null
R5518:Gm884 UTSW 11 103615253 missense probably benign 0.03
R5634:Gm884 UTSW 11 103542014 missense possibly damaging 0.95
R5647:Gm884 UTSW 11 103617474 unclassified probably benign
R5663:Gm884 UTSW 11 103613123 missense probably benign 0.01
R5668:Gm884 UTSW 11 103617054 unclassified probably benign
R5763:Gm884 UTSW 11 103613643 missense probably damaging 0.97
R5829:Gm884 UTSW 11 103541886 missense possibly damaging 0.95
R5871:Gm884 UTSW 11 103616454 unclassified probably benign
R5905:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R5940:Gm884 UTSW 11 103613886 missense probably benign 0.18
R5964:Gm884 UTSW 11 103542120 missense possibly damaging 0.92
R5988:Gm884 UTSW 11 103615896 unclassified probably benign
R5992:Gm884 UTSW 11 103613792 missense possibly damaging 0.81
R6114:Gm884 UTSW 11 103617791 unclassified probably benign
R6154:Gm884 UTSW 11 103614143 missense probably benign 0.33
R6233:Gm884 UTSW 11 103613388 missense probably damaging 0.98
R6301:Gm884 UTSW 11 103618930 unclassified probably benign
R6362:Gm884 UTSW 11 103620652 missense unknown
R6471:Gm884 UTSW 11 103619622 unclassified probably benign
R6806:Gm884 UTSW 11 103621124 missense unknown
R6962:Gm884 UTSW 11 103614300 missense possibly damaging 0.67
R6996:Gm884 UTSW 11 103618757 nonsense probably null
R7028:Gm884 UTSW 11 103614537 missense probably benign 0.28
R7034:Gm884 UTSW 11 103615812 unclassified probably benign
R7036:Gm884 UTSW 11 103615812 unclassified probably benign
R7113:Gm884 UTSW 11 103618799 missense unknown
R7405:Gm884 UTSW 11 103615161 missense probably benign 0.02
R7420:Gm884 UTSW 11 103613625 missense probably benign 0.11
R7461:Gm884 UTSW 11 103616290 missense unknown
R7544:Gm884 UTSW 11 103615448 missense probably benign 0.01
R7613:Gm884 UTSW 11 103616290 missense unknown
R7711:Gm884 UTSW 11 103614912 missense probably benign 0.02
R7714:Gm884 UTSW 11 103616893 missense unknown
R7747:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R7814:Gm884 UTSW 11 103614173 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGACGATTTCACCGAGGATC -3'
(R):5'- TGGAAAGAGCTGAGATGTCTC -3'

Sequencing Primer
(F):5'- GGACGATTTCACCGAGGATCTTTTC -3'
(R):5'- TCTCAGCAGAGAGAGACACAC -3'
Posted On2016-06-06