Mutagenetix > Incidental Mutation

Incidental Mutation 'R5030:Map1b'

391650

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

042621-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5030 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99434174 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 680 (K680E)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: K680E

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: K680E

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Meta Mutation Damage Score

0.0717

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

98% (87/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930584F24Rik	A	C	5: 26,479,785		noncoding transcript	Het
4932438A13Rik	A	G	3: 36,943,399		probably benign	Het
9330182L06Rik	T	A	5: 9,428,502	N455K	probably damaging	Het
Abca15	A	T	7: 120,340,001	E206V	probably damaging	Het
Acy1	A	G	9: 106,433,397	F343L	probably benign	Het
Adam22	T	C	5: 8,179,645		probably benign	Het
Adgrv1	A	T	13: 81,459,829	D4041E	probably benign	Het
Akr1c14	T	C	13: 4,079,102	S166P	probably damaging	Het
Alms1	T	A	6: 85,627,964	C2199S	probably damaging	Het
Atm	A	T	9: 53,520,109	Y316*	probably null	Het
Atp1a1	T	C	3: 101,579,817	D892G	probably benign	Het
Auts2	A	G	5: 131,443,498	V581A	probably benign	Het
Boll	T	A	1: 55,355,735	N57I	probably damaging	Het
C1s2	A	C	6: 124,635,588	V36G	possibly damaging	Het
Capza1	T	C	3: 104,840,838	Y70C	probably damaging	Het
Carnmt1	T	C	19: 18,691,586	S292P	possibly damaging	Het
Cyp2g1	T	G	7: 26,820,801	V486G	probably benign	Het
Dennd6b	T	A	15: 89,196,251	T49S	possibly damaging	Het
Dhx58	A	T	11: 100,696,137	I610N	probably damaging	Het
Fam170a	T	A	18: 50,281,954	N222K	probably benign	Het
Fbn1	A	G	2: 125,412,704	V213A	possibly damaging	Het
Frem3	A	C	8: 80,613,247	D723A	possibly damaging	Het
Fsip2	A	T	2: 82,988,492	K4856N	possibly damaging	Het
Galnt17	A	G	5: 130,876,513	V571A	probably damaging	Het
Gm6124	A	G	7: 39,223,030		noncoding transcript	Het
Gm884	G	A	11: 103,534,849	P1419S	unknown	Het
Gm8973	A	G	15: 99,006,255		noncoding transcript	Het
Gpd2	A	G	2: 57,304,405	T107A	probably damaging	Het
Hsd17b11	G	A	5: 104,003,292	A192V	probably damaging	Het
Igkv6-25	C	T	6: 70,215,442	Q4*	probably null	Het
Kalrn	A	G	16: 33,975,742	I1221T	probably benign	Het
Klhl9	G	T	4: 88,720,534	T490K	possibly damaging	Het
Lnpep	A	G	17: 17,579,309	V28A	probably damaging	Het
Man2c1	A	G	9: 57,140,639	H843R	probably benign	Het
Metap2	A	T	10: 93,879,677		probably null	Het
Mfsd2a	A	T	4: 122,950,156	I340N	possibly damaging	Het
Mgll	T	C	6: 88,818,665		probably null	Het
Mum1	T	C	10: 80,240,375		probably benign	Het
Myh9	A	G	15: 77,807,798		probably benign	Het
Ncapd3	A	T	9: 27,071,766	I937F	probably damaging	Het
Neb	T	C	2: 52,334,492		probably benign	Het
Nova1	A	G	12: 46,700,247	S416P	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1395	A	T	11: 49,148,361	M35L	probably benign	Het
Olfr502	T	A	7: 108,523,177	I258F	possibly damaging	Het
Olfr869	A	T	9: 20,138,067	K317M	probably benign	Het
Oosp3	T	C	19: 11,700,944	W95R	probably benign	Het
Pcdha7	T	A	18: 36,975,448	S509T	probably damaging	Het
Pdgfrb	T	C	18: 61,065,135	V296A	probably benign	Het
Pdzd2	A	T	15: 12,592,408	L50*	probably null	Het
Plcl2	G	T	17: 50,607,319	R452L	possibly damaging	Het
Poldip3	A	T	15: 83,138,191	F131I	possibly damaging	Het
Rffl	G	A	11: 82,812,717	R127*	probably null	Het
Sec24d	T	A	3: 123,358,901	V854E	probably damaging	Het
Sgo2a	T	A	1: 58,017,759	L1034*	probably null	Het
Slc39a4	C	T	15: 76,614,083	D385N	probably damaging	Het
Spaca1	A	T	4: 34,039,247	N95K	possibly damaging	Het
Spag17	C	T	3: 100,085,341	Q1718*	probably null	Het
Spdl1	C	T	11: 34,823,440	A141T	probably benign	Het
Stxbp3-ps	A	T	19: 9,558,350		noncoding transcript	Het
Supv3l1	G	T	10: 62,430,615	A594D	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tcrg-V7	G	T	13: 19,178,388	L82F	probably damaging	Het
Tmem131	T	C	1: 36,827,174	N483S	possibly damaging	Het
Tmem2	T	G	19: 21,842,105	F1087V	probably benign	Het
Tonsl	A	T	15: 76,638,101	C231S	probably damaging	Het
Trav9n-4	T	C	14: 53,294,848	F53S	possibly damaging	Het
Trim45	T	G	3: 100,928,072	V457G	probably damaging	Het
Trpm1	T	A	7: 64,235,831	I865N	probably damaging	Het
Trpm3	C	A	19: 22,698,766	L99I	probably benign	Het
Twist1	T	A	12: 33,958,441	L155Q	probably damaging	Het
Vac14	A	G	8: 110,710,386	E577G	possibly damaging	Het
Vmn1r184	T	C	7: 26,267,456	V209A	probably benign	Het
Xdh	C	T	17: 73,891,293	G1200R	probably damaging	Het
Zbbx	C	T	3: 75,083,683	D290N	possibly damaging	Het
Zbtb40	T	C	4: 136,997,952	T585A	probably benign	Het
Zc3h4	T	A	7: 16,422,230	D262E	unknown	Het
Zfp777	G	T	6: 48,037,667	D368E	probably damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TGGTTTTAACGCAGATGGCTTC -3'
(R):5'- CTGAGAAGCAAGCCACTGAG -3'

Sequencing Primer
(F):5'- AACGCAGATGGCTTCTTTGTGTC -3'
(R):5'- GAAGCAAGCCACTGAGAGCAAAC -3'

Posted On

2016-06-06