Incidental Mutation 'R5030:Pdzd2'
ID 391652
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene Name PDZ domain containing 2
Synonyms Pdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364
MMRRC Submission 042621-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R5030 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 12359711-12739924 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 12592408 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 50 (L50*)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000075317
AA Change: L50*
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: L50*

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189746
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A C 5: 26,479,785 noncoding transcript Het
4932438A13Rik A G 3: 36,943,399 probably benign Het
9330182L06Rik T A 5: 9,428,502 N455K probably damaging Het
Abca15 A T 7: 120,340,001 E206V probably damaging Het
Acy1 A G 9: 106,433,397 F343L probably benign Het
Adam22 T C 5: 8,179,645 probably benign Het
Adgrv1 A T 13: 81,459,829 D4041E probably benign Het
Akr1c14 T C 13: 4,079,102 S166P probably damaging Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Atm A T 9: 53,520,109 Y316* probably null Het
Atp1a1 T C 3: 101,579,817 D892G probably benign Het
Auts2 A G 5: 131,443,498 V581A probably benign Het
Boll T A 1: 55,355,735 N57I probably damaging Het
C1s2 A C 6: 124,635,588 V36G possibly damaging Het
Capza1 T C 3: 104,840,838 Y70C probably damaging Het
Carnmt1 T C 19: 18,691,586 S292P possibly damaging Het
Cyp2g1 T G 7: 26,820,801 V486G probably benign Het
Dennd6b T A 15: 89,196,251 T49S possibly damaging Het
Dhx58 A T 11: 100,696,137 I610N probably damaging Het
Fam170a T A 18: 50,281,954 N222K probably benign Het
Fbn1 A G 2: 125,412,704 V213A possibly damaging Het
Frem3 A C 8: 80,613,247 D723A possibly damaging Het
Fsip2 A T 2: 82,988,492 K4856N possibly damaging Het
Galnt17 A G 5: 130,876,513 V571A probably damaging Het
Gm6124 A G 7: 39,223,030 noncoding transcript Het
Gm884 G A 11: 103,534,849 P1419S unknown Het
Gm8973 A G 15: 99,006,255 noncoding transcript Het
Gpd2 A G 2: 57,304,405 T107A probably damaging Het
Hsd17b11 G A 5: 104,003,292 A192V probably damaging Het
Igkv6-25 C T 6: 70,215,442 Q4* probably null Het
Kalrn A G 16: 33,975,742 I1221T probably benign Het
Klhl9 G T 4: 88,720,534 T490K possibly damaging Het
Lnpep A G 17: 17,579,309 V28A probably damaging Het
Man2c1 A G 9: 57,140,639 H843R probably benign Het
Map1b T C 13: 99,434,174 K680E unknown Het
Metap2 A T 10: 93,879,677 probably null Het
Mfsd2a A T 4: 122,950,156 I340N possibly damaging Het
Mgll T C 6: 88,818,665 probably null Het
Mum1 T C 10: 80,240,375 probably benign Het
Myh9 A G 15: 77,807,798 probably benign Het
Ncapd3 A T 9: 27,071,766 I937F probably damaging Het
Neb T C 2: 52,334,492 probably benign Het
Nova1 A G 12: 46,700,247 S416P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1395 A T 11: 49,148,361 M35L probably benign Het
Olfr502 T A 7: 108,523,177 I258F possibly damaging Het
Olfr869 A T 9: 20,138,067 K317M probably benign Het
Oosp3 T C 19: 11,700,944 W95R probably benign Het
Pcdha7 T A 18: 36,975,448 S509T probably damaging Het
Pdgfrb T C 18: 61,065,135 V296A probably benign Het
Plcl2 G T 17: 50,607,319 R452L possibly damaging Het
Poldip3 A T 15: 83,138,191 F131I possibly damaging Het
Rffl G A 11: 82,812,717 R127* probably null Het
Sec24d T A 3: 123,358,901 V854E probably damaging Het
Sgo2a T A 1: 58,017,759 L1034* probably null Het
Slc39a4 C T 15: 76,614,083 D385N probably damaging Het
Spaca1 A T 4: 34,039,247 N95K possibly damaging Het
Spag17 C T 3: 100,085,341 Q1718* probably null Het
Spdl1 C T 11: 34,823,440 A141T probably benign Het
Stxbp3-ps A T 19: 9,558,350 noncoding transcript Het
Supv3l1 G T 10: 62,430,615 A594D probably damaging Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tcrg-V7 G T 13: 19,178,388 L82F probably damaging Het
Tmem131 T C 1: 36,827,174 N483S possibly damaging Het
Tmem2 T G 19: 21,842,105 F1087V probably benign Het
Tonsl A T 15: 76,638,101 C231S probably damaging Het
Trav9n-4 T C 14: 53,294,848 F53S possibly damaging Het
Trim45 T G 3: 100,928,072 V457G probably damaging Het
Trpm1 T A 7: 64,235,831 I865N probably damaging Het
Trpm3 C A 19: 22,698,766 L99I probably benign Het
Twist1 T A 12: 33,958,441 L155Q probably damaging Het
Vac14 A G 8: 110,710,386 E577G possibly damaging Het
Vmn1r184 T C 7: 26,267,456 V209A probably benign Het
Xdh C T 17: 73,891,293 G1200R probably damaging Het
Zbbx C T 3: 75,083,683 D290N possibly damaging Het
Zbtb40 T C 4: 136,997,952 T585A probably benign Het
Zc3h4 T A 7: 16,422,230 D262E unknown Het
Zfp777 G T 6: 48,037,667 D368E probably damaging Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12457983 missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12365767 splice site probably null
IGL00697:Pdzd2 APN 15 12373647 missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12374412 missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12374718 missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12402632 unclassified probably benign
IGL01389:Pdzd2 APN 15 12374626 missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12458207 missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12445664 missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12592483 missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12372546 missense probably benign
IGL01915:Pdzd2 APN 15 12371639 missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12592354 missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12376296 missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12445649 missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12375765 missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12411019 missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12385634 missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12592243 missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12376027 missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12374341 missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12382622 missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12385265 missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12388542 critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12373764 missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12399288 missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12371605 missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12375024 missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12592160 missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12592278 missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12376299 missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12458058 missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12399270 missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12374508 missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12371639 missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12389966 critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12373087 missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12457895 missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12458220 missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12385439 missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12411022 missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12373829 missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12372961 missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12385864 missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12592460 missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12387654 missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12390048 missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12373855 missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12457886 missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12373900 missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12373590 missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12406559 missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12375793 missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12373848 missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12373161 missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12375471 missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12376176 missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12375508 missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12387646 missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12375975 missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12419481 missense possibly damaging 0.48
R4656:Pdzd2 UTSW 15 12385711 missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12419516 missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12374595 missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12385343 missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R5174:Pdzd2 UTSW 15 12372514 missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12390033 missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12372942 missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12592177 missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12374281 missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12592350 nonsense probably null
R5704:Pdzd2 UTSW 15 12385675 missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12442589 missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12592570 splice site probably null
R6222:Pdzd2 UTSW 15 12374566 missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12458188 missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12592465 missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12385865 missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12374037 missense probably benign
R6955:Pdzd2 UTSW 15 12401464 missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12375907 missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12457859 missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12372561 missense probably benign 0.13
R7014:Pdzd2 UTSW 15 12372975 missense probably benign 0.14
R7110:Pdzd2 UTSW 15 12368013 missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12376123 missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12372973 missense probably benign 0.01
R7228:Pdzd2 UTSW 15 12458145 nonsense probably null
R7317:Pdzd2 UTSW 15 12592243 missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12437162 missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12399205 missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12372734 missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12373203 missense probably damaging 1.00
R7712:Pdzd2 UTSW 15 12407336 missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12373374 missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12374016 missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12385786 missense possibly damaging 0.60
R8017:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8019:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8108:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8109:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8110:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8111:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8145:Pdzd2 UTSW 15 12407372 missense probably benign 0.37
R8220:Pdzd2 UTSW 15 12592163 missense probably damaging 0.99
R8278:Pdzd2 UTSW 15 12375909 missense probably benign
R8768:Pdzd2 UTSW 15 12437166 missense probably damaging 1.00
R8879:Pdzd2 UTSW 15 12402319 missense probably damaging 1.00
R9019:Pdzd2 UTSW 15 12375526 missense probably damaging 1.00
R9030:Pdzd2 UTSW 15 12374299 missense probably benign 0.02
R9061:Pdzd2 UTSW 15 12374667 missense possibly damaging 0.94
R9302:Pdzd2 UTSW 15 12374256 missense possibly damaging 0.61
R9321:Pdzd2 UTSW 15 12385937 missense probably benign 0.00
R9421:Pdzd2 UTSW 15 12375028 missense
R9515:Pdzd2 UTSW 15 12374535 missense probably damaging 1.00
R9592:Pdzd2 UTSW 15 12458020 missense probably damaging 1.00
R9614:Pdzd2 UTSW 15 12375400 missense probably damaging 1.00
R9630:Pdzd2 UTSW 15 12374357 missense probably benign 0.37
R9776:Pdzd2 UTSW 15 12457823 missense probably benign 0.03
X0057:Pdzd2 UTSW 15 12411027 missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12368719 missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12372856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCGTTCAGGGAAAGGATCTC -3'
(R):5'- AGCAGGACCTCTCATGATGC -3'

Sequencing Primer
(F):5'- ATCCCGGAGCCGAACTTTC -3'
(R):5'- CAGGACCTCTCATGATGCTGGTG -3'
Posted On 2016-06-06