Mutagenetix > Incidental Mutations

Incidental Mutation 'R5030:Tonsl'

391654

Institutional Source

Beutler Lab

Gene Symbol

Tonsl

Ensembl Gene

ENSMUSG00000059323

Gene Name

tonsoku-like, DNA repair protein

Synonyms

Nfkbil2, 2810439M11Rik

MMRRC Submission

042621-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5030 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76626002-76639958 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 76638101 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 231 (C231S)

Ref Sequence

ENSEMBL: ENSMUSP00000129597 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165190] [ENSMUST00000166974] [ENSMUST00000168185]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163161

Predicted Effect

probably benign
Transcript: ENSMUST00000165190
AA Change: C231S

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000131368
Gene: ENSMUSG00000059323
AA Change: C231S

Domain	Start	End	E-Value	Type
TPR	27	60	5.33e1	SMART
Blast:TPR	67	100	4e-9	BLAST
TPR	162	195	1.77e1	SMART
TPR	202	235	1.36e1	SMART
low complexity region	259	271	N/A	INTRINSIC
TPR	311	344	1.4e1	SMART
TPR	352	385	7.27e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166974

Predicted Effect

probably damaging
Transcript: ENSMUST00000168185
AA Change: C231S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129597
Gene: ENSMUSG00000059323
AA Change: C231S

Domain	Start	End	E-Value	Type
TPR	27	60	5.33e1	SMART
Blast:TPR	67	100	7e-9	BLAST
TPR	162	195	1.77e1	SMART
TPR	202	235	1.36e1	SMART
Pfam:TPR_8	242	274	8.7e-3	PFAM
TPR	311	344	1.4e1	SMART
TPR	352	385	7.27e0	SMART
low complexity region	413	437	N/A	INTRINSIC
low complexity region	465	494	N/A	INTRINSIC
low complexity region	500	511	N/A	INTRINSIC
ANK	528	559	8.36e1	SMART
ANK	561	590	4.85e-8	SMART
ANK	597	626	2.85e-5	SMART
low complexity region	690	707	N/A	INTRINSIC
low complexity region	729	753	N/A	INTRINSIC
low complexity region	1031	1044	N/A	INTRINSIC
LRR	1058	1085	2.86e-1	SMART
LRR	1086	1113	5.88e-1	SMART
LRR	1117	1144	1.67e-2	SMART
LRR	1177	1204	2.72e0	SMART
LRR	1236	1263	7.02e0	SMART
LRR	1264	1292	1.46e2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168432

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171478

Meta Mutation Damage Score

0.5435

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

98% (87/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a negative regulator of NF-kappa-B mediated transcription. The encoded protein may bind NF-kappa-B complexes and trap them in the cytoplasm, preventing them from entering the nucleus and interacting with the DNA. Phosphorylation of this protein targets it for degradation by the ubiquitination pathway, which frees the NF-kappa-B complexes to enter the nucleus. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930584F24Rik	A	C	5: 26,479,785		noncoding transcript	Het
4932438A13Rik	A	G	3: 36,943,399		probably benign	Het
9330182L06Rik	T	A	5: 9,428,502	N455K	probably damaging	Het
Abca15	A	T	7: 120,340,001	E206V	probably damaging	Het
Acy1	A	G	9: 106,433,397	F343L	probably benign	Het
Adam22	T	C	5: 8,179,645		probably benign	Het
Adgrv1	A	T	13: 81,459,829	D4041E	probably benign	Het
Akr1c14	T	C	13: 4,079,102	S166P	probably damaging	Het
Alms1	T	A	6: 85,627,964	C2199S	probably damaging	Het
Atm	A	T	9: 53,520,109	Y316*	probably null	Het
Atp1a1	T	C	3: 101,579,817	D892G	probably benign	Het
Auts2	A	G	5: 131,443,498	V581A	probably benign	Het
Boll	T	A	1: 55,355,735	N57I	probably damaging	Het
C1s2	A	C	6: 124,635,588	V36G	possibly damaging	Het
Capza1	T	C	3: 104,840,838	Y70C	probably damaging	Het
Carnmt1	T	C	19: 18,691,586	S292P	possibly damaging	Het
Cyp2g1	T	G	7: 26,820,801	V486G	probably benign	Het
Dennd6b	T	A	15: 89,196,251	T49S	possibly damaging	Het
Dhx58	A	T	11: 100,696,137	I610N	probably damaging	Het
Fam170a	T	A	18: 50,281,954	N222K	probably benign	Het
Fbn1	A	G	2: 125,412,704	V213A	possibly damaging	Het
Frem3	A	C	8: 80,613,247	D723A	possibly damaging	Het
Fsip2	A	T	2: 82,988,492	K4856N	possibly damaging	Het
Galnt17	A	G	5: 130,876,513	V571A	probably damaging	Het
Gm6124	A	G	7: 39,223,030		noncoding transcript	Het
Gm884	G	A	11: 103,534,849	P1419S	unknown	Het
Gm8973	A	G	15: 99,006,255		noncoding transcript	Het
Gpd2	A	G	2: 57,304,405	T107A	probably damaging	Het
Hsd17b11	G	A	5: 104,003,292	A192V	probably damaging	Het
Igkv6-25	C	T	6: 70,215,442	Q4*	probably null	Het
Kalrn	A	G	16: 33,975,742	I1221T	probably benign	Het
Klhl9	G	T	4: 88,720,534	T490K	possibly damaging	Het
Lnpep	A	G	17: 17,579,309	V28A	probably damaging	Het
Man2c1	A	G	9: 57,140,639	H843R	probably benign	Het
Map1b	T	C	13: 99,434,174	K680E	unknown	Het
Metap2	A	T	10: 93,879,677		probably null	Het
Mfsd2a	A	T	4: 122,950,156	I340N	possibly damaging	Het
Mgll	T	C	6: 88,818,665		probably null	Het
Mum1	T	C	10: 80,240,375		probably benign	Het
Myh9	A	G	15: 77,807,798		probably benign	Het
Ncapd3	A	T	9: 27,071,766	I937F	probably damaging	Het
Neb	T	C	2: 52,334,492		probably benign	Het
Nova1	A	G	12: 46,700,247	S416P	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1395	A	T	11: 49,148,361	M35L	probably benign	Het
Olfr502	T	A	7: 108,523,177	I258F	possibly damaging	Het
Olfr869	A	T	9: 20,138,067	K317M	probably benign	Het
Oosp3	T	C	19: 11,700,944	W95R	probably benign	Het
Pcdha7	T	A	18: 36,975,448	S509T	probably damaging	Het
Pdgfrb	T	C	18: 61,065,135	V296A	probably benign	Het
Pdzd2	A	T	15: 12,592,408	L50*	probably null	Het
Plcl2	G	T	17: 50,607,319	R452L	possibly damaging	Het
Poldip3	A	T	15: 83,138,191	F131I	possibly damaging	Het
Rffl	G	A	11: 82,812,717	R127*	probably null	Het
Sec24d	T	A	3: 123,358,901	V854E	probably damaging	Het
Sgo2a	T	A	1: 58,017,759	L1034*	probably null	Het
Slc39a4	C	T	15: 76,614,083	D385N	probably damaging	Het
Spaca1	A	T	4: 34,039,247	N95K	possibly damaging	Het
Spag17	C	T	3: 100,085,341	Q1718*	probably null	Het
Spdl1	C	T	11: 34,823,440	A141T	probably benign	Het
Stxbp3-ps	A	T	19: 9,558,350		noncoding transcript	Het
Supv3l1	G	T	10: 62,430,615	A594D	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tcrg-V7	G	T	13: 19,178,388	L82F	probably damaging	Het
Tmem131	T	C	1: 36,827,174	N483S	possibly damaging	Het
Tmem2	T	G	19: 21,842,105	F1087V	probably benign	Het
Trav9n-4	T	C	14: 53,294,848	F53S	possibly damaging	Het
Trim45	T	G	3: 100,928,072	V457G	probably damaging	Het
Trpm1	T	A	7: 64,235,831	I865N	probably damaging	Het
Trpm3	C	A	19: 22,698,766	L99I	probably benign	Het
Twist1	T	A	12: 33,958,441	L155Q	probably damaging	Het
Vac14	A	G	8: 110,710,386	E577G	possibly damaging	Het
Vmn1r184	T	C	7: 26,267,456	V209A	probably benign	Het
Xdh	C	T	17: 73,891,293	G1200R	probably damaging	Het
Zbbx	C	T	3: 75,083,683	D290N	possibly damaging	Het
Zbtb40	T	C	4: 136,997,952	T585A	probably benign	Het
Zc3h4	T	A	7: 16,422,230	D262E	unknown	Het
Zfp777	G	T	6: 48,037,667	D368E	probably damaging	Het

Other mutations in Tonsl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Tonsl	APN	15	76638496	missense	possibly damaging	0.78
IGL00763:Tonsl	APN	15	76633868	missense	probably damaging	1.00
IGL00796:Tonsl	APN	15	76625149	missense	probably benign
IGL00965:Tonsl	APN	15	76631880	splice site	probably benign
IGL01434:Tonsl	APN	15	76631102	missense	probably benign	0.11
IGL01859:Tonsl	APN	15	76634780	missense	probably damaging	0.97
IGL02112:Tonsl	APN	15	76633402	missense	probably benign	0.01
IGL02189:Tonsl	APN	15	76623178	missense	possibly damaging	0.56
IGL02281:Tonsl	APN	15	76634074	missense	probably damaging	1.00
IGL02627:Tonsl	APN	15	76634095	missense	probably damaging	0.99
IGL02750:Tonsl	APN	15	76633389	missense	probably damaging	0.97
IGL02977:Tonsl	APN	15	76632873	missense	probably benign	0.00
R0127:Tonsl	UTSW	15	76633485	missense	probably benign	0.01
R0316:Tonsl	UTSW	15	76629300	missense	possibly damaging	0.68
R0443:Tonsl	UTSW	15	76639684	missense	probably benign
R0714:Tonsl	UTSW	15	76633721	splice site	probably benign
R0946:Tonsl	UTSW	15	76623221	missense	probably benign	0.03
R0975:Tonsl	UTSW	15	76638932	missense	probably damaging	0.99
R1263:Tonsl	UTSW	15	76622562	missense	possibly damaging	0.85
R1468:Tonsl	UTSW	15	76636561	critical splice donor site	probably null
R1468:Tonsl	UTSW	15	76636561	critical splice donor site	probably null
R1610:Tonsl	UTSW	15	76638557	missense	probably damaging	1.00
R1623:Tonsl	UTSW	15	76638509	missense	probably damaging	1.00
R1763:Tonsl	UTSW	15	76638066	missense	probably damaging	1.00
R1882:Tonsl	UTSW	15	76624150	missense	possibly damaging	0.83
R1898:Tonsl	UTSW	15	76638853	unclassified	probably null
R1932:Tonsl	UTSW	15	76624597	missense	probably damaging	0.97
R2141:Tonsl	UTSW	15	76632661	missense	probably damaging	0.99
R2166:Tonsl	UTSW	15	76637313	missense	probably benign	0.13
R2191:Tonsl	UTSW	15	76632680	missense	probably damaging	0.96
R2198:Tonsl	UTSW	15	76636672	missense	probably benign	0.00
R2219:Tonsl	UTSW	15	76634640	missense	probably damaging	1.00
R2762:Tonsl	UTSW	15	76630620	missense	probably damaging	1.00
R3156:Tonsl	UTSW	15	76639521	missense	probably damaging	1.00
R3508:Tonsl	UTSW	15	76639756	missense	probably benign
R4012:Tonsl	UTSW	15	76637044	missense	probably damaging	1.00
R4179:Tonsl	UTSW	15	76624475	missense	probably damaging	1.00
R4180:Tonsl	UTSW	15	76624475	missense	probably damaging	1.00
R4327:Tonsl	UTSW	15	76639716	missense	probably benign
R4627:Tonsl	UTSW	15	76637224	missense	probably damaging	1.00
R4671:Tonsl	UTSW	15	76623410	missense	probably benign	0.01
R4825:Tonsl	UTSW	15	76633248	missense	probably benign	0.34
R4840:Tonsl	UTSW	15	76633209	missense	probably benign
R5143:Tonsl	UTSW	15	76636657	missense	possibly damaging	0.80
R6238:Tonsl	UTSW	15	76636218	unclassified	probably null
R6379:Tonsl	UTSW	15	76629742	missense	probably benign
R6401:Tonsl	UTSW	15	76633666	missense	probably damaging	1.00
R6534:Tonsl	UTSW	15	76629677	missense	probably damaging	1.00
R6695:Tonsl	UTSW	15	76629818	missense	possibly damaging	0.84
R6701:Tonsl	UTSW	15	76629300	missense	probably damaging	1.00
R7138:Tonsl	UTSW	15	76634776	missense	probably benign
R7206:Tonsl	UTSW	15	76633651	missense	probably damaging	1.00
R7287:Tonsl	UTSW	15	76633725	intron	probably null
R7615:Tonsl	UTSW	15	76630607	missense	probably benign	0.44
R7626:Tonsl	UTSW	15	76633936	missense	probably null	1.00
R7641:Tonsl	UTSW	15	76633652	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGGTTAGGCTTCTGAGAGCC -3'
(R):5'- GGTGTCTCACTGTTCCAAGG -3'

Sequencing Primer
(F):5'- GCTTCTGAGAGCCCAACCTATAGG -3'
(R):5'- CTGAGCTCCTATTACCCCAT -3'

Posted On

2016-06-06