Incidental Mutation 'R5030:Xdh'
ID 391662
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms xanthine oxidase, XO, Xor, Xox1, Xox-1
MMRRC Submission 042621-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.356) question?
Stock # R5030 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 73883908-73950182 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 73891293 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 1200 (G1200R)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: G1200R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: G1200R

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.8860 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A C 5: 26,479,785 noncoding transcript Het
4932438A13Rik A G 3: 36,943,399 probably benign Het
9330182L06Rik T A 5: 9,428,502 N455K probably damaging Het
Abca15 A T 7: 120,340,001 E206V probably damaging Het
Acy1 A G 9: 106,433,397 F343L probably benign Het
Adam22 T C 5: 8,179,645 probably benign Het
Adgrv1 A T 13: 81,459,829 D4041E probably benign Het
Akr1c14 T C 13: 4,079,102 S166P probably damaging Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Atm A T 9: 53,520,109 Y316* probably null Het
Atp1a1 T C 3: 101,579,817 D892G probably benign Het
Auts2 A G 5: 131,443,498 V581A probably benign Het
Boll T A 1: 55,355,735 N57I probably damaging Het
C1s2 A C 6: 124,635,588 V36G possibly damaging Het
Capza1 T C 3: 104,840,838 Y70C probably damaging Het
Carnmt1 T C 19: 18,691,586 S292P possibly damaging Het
Cyp2g1 T G 7: 26,820,801 V486G probably benign Het
Dennd6b T A 15: 89,196,251 T49S possibly damaging Het
Dhx58 A T 11: 100,696,137 I610N probably damaging Het
Fam170a T A 18: 50,281,954 N222K probably benign Het
Fbn1 A G 2: 125,412,704 V213A possibly damaging Het
Frem3 A C 8: 80,613,247 D723A possibly damaging Het
Fsip2 A T 2: 82,988,492 K4856N possibly damaging Het
Galnt17 A G 5: 130,876,513 V571A probably damaging Het
Gm6124 A G 7: 39,223,030 noncoding transcript Het
Gm884 G A 11: 103,534,849 P1419S unknown Het
Gm8973 A G 15: 99,006,255 noncoding transcript Het
Gpd2 A G 2: 57,304,405 T107A probably damaging Het
Hsd17b11 G A 5: 104,003,292 A192V probably damaging Het
Igkv6-25 C T 6: 70,215,442 Q4* probably null Het
Kalrn A G 16: 33,975,742 I1221T probably benign Het
Klhl9 G T 4: 88,720,534 T490K possibly damaging Het
Lnpep A G 17: 17,579,309 V28A probably damaging Het
Man2c1 A G 9: 57,140,639 H843R probably benign Het
Map1b T C 13: 99,434,174 K680E unknown Het
Metap2 A T 10: 93,879,677 probably null Het
Mfsd2a A T 4: 122,950,156 I340N possibly damaging Het
Mgll T C 6: 88,818,665 probably null Het
Mum1 T C 10: 80,240,375 probably benign Het
Myh9 A G 15: 77,807,798 probably benign Het
Ncapd3 A T 9: 27,071,766 I937F probably damaging Het
Neb T C 2: 52,334,492 probably benign Het
Nova1 A G 12: 46,700,247 S416P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1395 A T 11: 49,148,361 M35L probably benign Het
Olfr502 T A 7: 108,523,177 I258F possibly damaging Het
Olfr869 A T 9: 20,138,067 K317M probably benign Het
Oosp3 T C 19: 11,700,944 W95R probably benign Het
Pcdha7 T A 18: 36,975,448 S509T probably damaging Het
Pdgfrb T C 18: 61,065,135 V296A probably benign Het
Pdzd2 A T 15: 12,592,408 L50* probably null Het
Plcl2 G T 17: 50,607,319 R452L possibly damaging Het
Poldip3 A T 15: 83,138,191 F131I possibly damaging Het
Rffl G A 11: 82,812,717 R127* probably null Het
Sec24d T A 3: 123,358,901 V854E probably damaging Het
Sgo2a T A 1: 58,017,759 L1034* probably null Het
Slc39a4 C T 15: 76,614,083 D385N probably damaging Het
Spaca1 A T 4: 34,039,247 N95K possibly damaging Het
Spag17 C T 3: 100,085,341 Q1718* probably null Het
Spdl1 C T 11: 34,823,440 A141T probably benign Het
Stxbp3-ps A T 19: 9,558,350 noncoding transcript Het
Supv3l1 G T 10: 62,430,615 A594D probably damaging Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tcrg-V7 G T 13: 19,178,388 L82F probably damaging Het
Tmem131 T C 1: 36,827,174 N483S possibly damaging Het
Tmem2 T G 19: 21,842,105 F1087V probably benign Het
Tonsl A T 15: 76,638,101 C231S probably damaging Het
Trav9n-4 T C 14: 53,294,848 F53S possibly damaging Het
Trim45 T G 3: 100,928,072 V457G probably damaging Het
Trpm1 T A 7: 64,235,831 I865N probably damaging Het
Trpm3 C A 19: 22,698,766 L99I probably benign Het
Twist1 T A 12: 33,958,441 L155Q probably damaging Het
Vac14 A G 8: 110,710,386 E577G possibly damaging Het
Vmn1r184 T C 7: 26,267,456 V209A probably benign Het
Zbbx C T 3: 75,083,683 D290N possibly damaging Het
Zbtb40 T C 4: 136,997,952 T585A probably benign Het
Zc3h4 T A 7: 16,422,230 D262E unknown Het
Zfp777 G T 6: 48,037,667 D368E probably damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
inky UTSW 17 73921351 missense probably damaging 1.00
nucleus UTSW 17 73899012 nonsense probably null
squidgame UTSW 17 73939836 missense probably benign
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8350:Xdh UTSW 17 73934842 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
R8465:Xdh UTSW 17 73899012 nonsense probably null
R8478:Xdh UTSW 17 73906058 missense probably benign 0.00
R8680:Xdh UTSW 17 73922505 missense probably benign
R8802:Xdh UTSW 17 73918410 missense probably benign 0.00
R8984:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8985:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8995:Xdh UTSW 17 73898374 missense probably damaging 1.00
R9035:Xdh UTSW 17 73910227 missense probably benign
R9149:Xdh UTSW 17 73915693 missense probably benign
R9181:Xdh UTSW 17 73925011 missense probably damaging 1.00
R9357:Xdh UTSW 17 73907716 missense probably damaging 0.97
R9357:Xdh UTSW 17 73926546 critical splice donor site probably null
R9609:Xdh UTSW 17 73924995 missense possibly damaging 0.91
R9803:Xdh UTSW 17 73922460 missense probably benign
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATGCATAGATGGCCCTC -3'
(R):5'- TCTGCCGACACATTCTGAAC -3'

Sequencing Primer
(F):5'- ATGCATAGATGGCCCTCTTGTTG -3'
(R):5'- CACATTCTGAACAGAGGGATGCTC -3'
Posted On 2016-06-06