Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:Irs1'

391671

Institutional Source

Beutler Lab

Gene Symbol

Irs1

Ensembl Gene

ENSMUSG00000055980

Gene Name

insulin receptor substrate 1

Synonyms

G972R, IRS-1

MMRRC Submission

042622-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.639) question?

Stock #

R5031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82233101-82291416 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 82286967 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 1176 (L1176*)

Ref Sequence

ENSEMBL: ENSMUSP00000063795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069799]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000069799
AA Change: L1176*

SMART Domains

Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: L1176*

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,664,514	N136S	probably damaging	Het
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
Atr	A	G	9: 95,865,702	K346E	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Baz2b	T	C	2: 59,912,807	R1607G	probably benign	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Dock1	A	G	7: 135,152,246	D1584G	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gsap	G	A	5: 21,242,826	S294N	possibly damaging	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Klhl29	C	T	12: 5,091,334	R550Q	probably benign	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Magel2	T	C	7: 62,380,104	S919P	unknown	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Pik3cb	C	T	9: 99,071,408	D441N	probably damaging	Het
Qrich1	C	T	9: 108,541,736	P464S	possibly damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tram1l1	T	A	3: 124,321,644	L151*	probably null	Het
Trappc12	T	A	12: 28,692,513	I682L	possibly damaging	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Trpm8	A	G	1: 88,348,188	T503A	probably benign	Het
Virma	T	A	4: 11,542,116	Y1567*	probably null	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in Irs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Irs1	APN	1	82288483	missense	probably benign	0.01
IGL00534:Irs1	APN	1	82288471	missense	probably benign
IGL01926:Irs1	APN	1	82289959	missense	probably damaging	0.98
IGL02130:Irs1	APN	1	82289467	missense	probably damaging	1.00
IGL03338:Irs1	APN	1	82288401	missense	probably benign	0.05
Hoverboard	UTSW	1	82290098	nonsense	probably null
runt	UTSW	1	82287732	frame shift	probably null
runt2	UTSW	1	82286967	nonsense	probably null
Sprite	UTSW	1	82288109	nonsense	probably null
R0019:Irs1	UTSW	1	82287256	nonsense	probably null
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0318:Irs1	UTSW	1	82288660	missense	probably benign	0.01
R1199:Irs1	UTSW	1	82289626	missense	probably damaging	1.00
R1363:Irs1	UTSW	1	82287288	missense	probably benign	0.02
R1584:Irs1	UTSW	1	82289444	missense	probably benign	0.24
R1874:Irs1	UTSW	1	82289853	frame shift	probably null
R1903:Irs1	UTSW	1	82289461	missense	probably damaging	1.00
R1929:Irs1	UTSW	1	82288459	missense	probably benign
R1986:Irs1	UTSW	1	82288765	missense	probably damaging	1.00
R2136:Irs1	UTSW	1	82290042	missense	probably damaging	1.00
R2179:Irs1	UTSW	1	82290219	missense	possibly damaging	0.81
R2271:Irs1	UTSW	1	82288459	missense	probably benign
R2760:Irs1	UTSW	1	82288570	missense	probably damaging	1.00
R3721:Irs1	UTSW	1	82290085	missense	probably benign	0.11
R3821:Irs1	UTSW	1	82290049	missense	probably benign
R4306:Irs1	UTSW	1	82287964	missense	probably benign	0.11
R4420:Irs1	UTSW	1	82288450	missense	possibly damaging	0.94
R4451:Irs1	UTSW	1	82289028	missense	probably benign	0.00
R4479:Irs1	UTSW	1	82287294	missense	probably damaging	1.00
R4771:Irs1	UTSW	1	82287975	missense	probably benign	0.00
R4782:Irs1	UTSW	1	82287463	missense	probably benign	0.00
R4836:Irs1	UTSW	1	82287732	frame shift	probably null
R4880:Irs1	UTSW	1	82287732	frame shift	probably null
R4881:Irs1	UTSW	1	82287732	frame shift	probably null
R5053:Irs1	UTSW	1	82286922	missense	probably benign
R5418:Irs1	UTSW	1	82288770	missense	probably damaging	1.00
R5595:Irs1	UTSW	1	82289925	missense	probably damaging	1.00
R5698:Irs1	UTSW	1	82288734	missense	probably benign	0.01
R6381:Irs1	UTSW	1	82287684	missense	possibly damaging	0.66
R6563:Irs1	UTSW	1	82288407	missense	probably damaging	0.98
R7002:Irs1	UTSW	1	82288260	missense	probably benign	0.13
R7095:Irs1	UTSW	1	82290098	nonsense	probably null
R7195:Irs1	UTSW	1	82287456	missense	probably benign	0.13
R7216:Irs1	UTSW	1	82289755	missense	probably damaging	0.98
R7361:Irs1	UTSW	1	82289114	nonsense	probably null
R7490:Irs1	UTSW	1	82287264	missense	probably damaging	0.99
R7540:Irs1	UTSW	1	82288002	missense	not run
R7706:Irs1	UTSW	1	82287691	missense	probably damaging	1.00
R7910:Irs1	UTSW	1	82290081	missense	probably benign	0.06
R7912:Irs1	UTSW	1	82289884	missense	probably benign
R7962:Irs1	UTSW	1	82288722	missense	possibly damaging	0.57
R8139:Irs1	UTSW	1	82289739	missense	probably damaging	1.00
R8158:Irs1	UTSW	1	82289533	missense	probably damaging	1.00
R8159:Irs1	UTSW	1	82288569	missense	probably damaging	1.00
R8187:Irs1	UTSW	1	82288300	missense	probably damaging	1.00
R8288:Irs1	UTSW	1	82287961	nonsense	probably null
R8436:Irs1	UTSW	1	82290249	missense	possibly damaging	0.96
R8865:Irs1	UTSW	1	82288109	nonsense	probably null
R8950:Irs1	UTSW	1	82286931	missense	probably benign
R9591:Irs1	UTSW	1	82288248	missense	probably benign	0.00
X0063:Irs1	UTSW	1	82288908	missense	probably damaging	1.00
X0065:Irs1	UTSW	1	82289365	missense	probably damaging	1.00
Z1177:Irs1	UTSW	1	82288996	missense	possibly damaging	0.87
Z1177:Irs1	UTSW	1	82290394	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- ACGCTATTGACGATCCTCTG -3'
(R):5'- GAGACCTTCTCAGCACCTACTC -3'

Sequencing Primer
(F):5'- ATCCTCTGGCTGCTTCTGGAAG -3'
(R):5'- AATACGGTGCCCTTTGGAGC -3'

Posted On

2016-06-06