Incidental Mutation 'R5031:Irs1'
ID 391671
Institutional Source Beutler Lab
Gene Symbol Irs1
Ensembl Gene ENSMUSG00000055980
Gene Name insulin receptor substrate 1
Synonyms G972R, IRS-1
MMRRC Submission 042622-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.620) question?
Stock # R5031 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 82210822-82269137 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 82264688 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 1176 (L1176*)
Ref Sequence ENSEMBL: ENSMUSP00000063795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069799]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000069799
AA Change: L1176*
SMART Domains Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: L1176*

DomainStartEndE-ValueType
PH 13 117 8.13e-14 SMART
low complexity region 123 143 N/A INTRINSIC
IRS 155 257 1.19e-35 SMART
PTBI 155 257 7.8e-60 SMART
low complexity region 263 276 N/A INTRINSIC
low complexity region 378 399 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
low complexity region 662 689 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 1019 1040 N/A INTRINSIC
low complexity region 1051 1062 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,247,678 (GRCm39) N2475I probably damaging Het
Acnat2 T C 4: 49,380,631 (GRCm39) K231R probably damaging Het
Ank1 C T 8: 23,589,696 (GRCm39) P599L probably damaging Het
Arhgef19 A G 4: 140,978,121 (GRCm39) E580G probably damaging Het
Atr A G 9: 95,747,755 (GRCm39) K346E probably damaging Het
AU021092 T C 16: 5,030,468 (GRCm39) K309E probably damaging Het
Baz2b T C 2: 59,743,151 (GRCm39) R1607G probably benign Het
Cct8 C T 16: 87,284,426 (GRCm39) V254M probably damaging Het
Cdca2 T A 14: 67,950,602 (GRCm39) I110F probably damaging Het
Csmd3 A T 15: 47,522,588 (GRCm39) C2694S probably damaging Het
Dmkn A G 7: 30,463,661 (GRCm39) I105V probably benign Het
Dock1 A G 7: 134,753,975 (GRCm39) D1584G probably benign Het
Epg5 G A 18: 78,072,163 (GRCm39) V2392I probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Gsap G A 5: 21,447,824 (GRCm39) S294N possibly damaging Het
Hectd2 A G 19: 36,577,004 (GRCm39) N142D probably damaging Het
Hmcn1 A G 1: 150,464,008 (GRCm39) C5091R probably damaging Het
Ifitm5 G A 7: 140,530,017 (GRCm39) R36* probably null Het
Ints2 G A 11: 86,147,026 (GRCm39) P40L probably damaging Het
Klhl29 C T 12: 5,141,334 (GRCm39) R550Q probably benign Het
Kyat1 A G 2: 30,078,102 (GRCm39) M134T probably damaging Het
Lrrk2 A T 15: 91,584,822 (GRCm39) N384Y possibly damaging Het
Magel2 T C 7: 62,029,852 (GRCm39) S919P unknown Het
Mettl16 A T 11: 74,693,825 (GRCm39) I279F probably benign Het
Mmut T C 17: 41,249,718 (GRCm39) F231S possibly damaging Het
Mrgpra1 A T 7: 46,984,985 (GRCm39) Y231* probably null Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Mvp A C 7: 126,592,788 (GRCm39) Y374* probably null Het
Nabp2 G A 10: 128,245,497 (GRCm39) probably benign Het
Nos1 C T 5: 118,017,378 (GRCm39) P247L probably benign Het
Or10ag53 C A 2: 87,082,426 (GRCm39) F48L probably benign Het
Or9g4b T A 2: 85,616,062 (GRCm39) L69* probably null Het
Pik3cb C T 9: 98,953,461 (GRCm39) D441N probably damaging Het
Qrich1 C T 9: 108,418,935 (GRCm39) P464S possibly damaging Het
Rab17 A T 1: 90,887,860 (GRCm39) probably null Het
Relch A G 1: 105,592,239 (GRCm39) N136S probably damaging Het
Rspo3 A T 10: 29,382,443 (GRCm39) L77H probably damaging Het
Spn G T 7: 126,736,402 (GRCm39) T35K probably benign Het
Sult1d1 T A 5: 87,707,703 (GRCm39) Y139F possibly damaging Het
Tbc1d32 C A 10: 55,999,627 (GRCm39) Q848H probably damaging Het
Tcaf3 A G 6: 42,573,867 (GRCm39) V115A probably benign Het
Tram1l1 T A 3: 124,115,293 (GRCm39) L151* probably null Het
Trappc12 T A 12: 28,742,512 (GRCm39) I682L possibly damaging Het
Trav6d-4 A C 14: 52,991,056 (GRCm39) T31P probably damaging Het
Trpm8 A G 1: 88,275,910 (GRCm39) T503A probably benign Het
Virma T A 4: 11,542,116 (GRCm39) Y1567* probably null Het
Vmn1r228 T A 17: 20,996,943 (GRCm39) K192* probably null Het
Zfp521 T A 18: 13,977,330 (GRCm39) T1028S possibly damaging Het
Zfp583 T A 7: 6,320,397 (GRCm39) Q205L probably benign Het
Other mutations in Irs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Irs1 APN 1 82,266,204 (GRCm39) missense probably benign 0.01
IGL00534:Irs1 APN 1 82,266,192 (GRCm39) missense probably benign
IGL01926:Irs1 APN 1 82,267,680 (GRCm39) missense probably damaging 0.98
IGL02130:Irs1 APN 1 82,267,188 (GRCm39) missense probably damaging 1.00
IGL03338:Irs1 APN 1 82,266,122 (GRCm39) missense probably benign 0.05
Hoverboard UTSW 1 82,267,819 (GRCm39) nonsense probably null
runt UTSW 1 82,265,453 (GRCm39) frame shift probably null
runt2 UTSW 1 82,264,688 (GRCm39) nonsense probably null
Sprite UTSW 1 82,265,830 (GRCm39) nonsense probably null
R0019:Irs1 UTSW 1 82,264,977 (GRCm39) nonsense probably null
R0063:Irs1 UTSW 1 82,266,580 (GRCm39) missense probably damaging 1.00
R0063:Irs1 UTSW 1 82,266,580 (GRCm39) missense probably damaging 1.00
R0318:Irs1 UTSW 1 82,266,381 (GRCm39) missense probably benign 0.01
R1199:Irs1 UTSW 1 82,267,347 (GRCm39) missense probably damaging 1.00
R1363:Irs1 UTSW 1 82,265,009 (GRCm39) missense probably benign 0.02
R1584:Irs1 UTSW 1 82,267,165 (GRCm39) missense probably benign 0.24
R1874:Irs1 UTSW 1 82,267,574 (GRCm39) frame shift probably null
R1903:Irs1 UTSW 1 82,267,182 (GRCm39) missense probably damaging 1.00
R1929:Irs1 UTSW 1 82,266,180 (GRCm39) missense probably benign
R1986:Irs1 UTSW 1 82,266,486 (GRCm39) missense probably damaging 1.00
R2136:Irs1 UTSW 1 82,267,763 (GRCm39) missense probably damaging 1.00
R2179:Irs1 UTSW 1 82,267,940 (GRCm39) missense possibly damaging 0.81
R2271:Irs1 UTSW 1 82,266,180 (GRCm39) missense probably benign
R2760:Irs1 UTSW 1 82,266,291 (GRCm39) missense probably damaging 1.00
R3721:Irs1 UTSW 1 82,267,806 (GRCm39) missense probably benign 0.11
R3821:Irs1 UTSW 1 82,267,770 (GRCm39) missense probably benign
R4306:Irs1 UTSW 1 82,265,685 (GRCm39) missense probably benign 0.11
R4420:Irs1 UTSW 1 82,266,171 (GRCm39) missense possibly damaging 0.94
R4451:Irs1 UTSW 1 82,266,749 (GRCm39) missense probably benign 0.00
R4479:Irs1 UTSW 1 82,265,015 (GRCm39) missense probably damaging 1.00
R4771:Irs1 UTSW 1 82,265,696 (GRCm39) missense probably benign 0.00
R4782:Irs1 UTSW 1 82,265,184 (GRCm39) missense probably benign 0.00
R4836:Irs1 UTSW 1 82,265,453 (GRCm39) frame shift probably null
R4880:Irs1 UTSW 1 82,265,453 (GRCm39) frame shift probably null
R4881:Irs1 UTSW 1 82,265,453 (GRCm39) frame shift probably null
R5053:Irs1 UTSW 1 82,264,643 (GRCm39) missense probably benign
R5418:Irs1 UTSW 1 82,266,491 (GRCm39) missense probably damaging 1.00
R5595:Irs1 UTSW 1 82,267,646 (GRCm39) missense probably damaging 1.00
R5698:Irs1 UTSW 1 82,266,455 (GRCm39) missense probably benign 0.01
R6381:Irs1 UTSW 1 82,265,405 (GRCm39) missense possibly damaging 0.66
R6563:Irs1 UTSW 1 82,266,128 (GRCm39) missense probably damaging 0.98
R7002:Irs1 UTSW 1 82,265,981 (GRCm39) missense probably benign 0.13
R7095:Irs1 UTSW 1 82,267,819 (GRCm39) nonsense probably null
R7195:Irs1 UTSW 1 82,265,177 (GRCm39) missense probably benign 0.13
R7216:Irs1 UTSW 1 82,267,476 (GRCm39) missense probably damaging 0.98
R7361:Irs1 UTSW 1 82,266,835 (GRCm39) nonsense probably null
R7490:Irs1 UTSW 1 82,264,985 (GRCm39) missense probably damaging 0.99
R7540:Irs1 UTSW 1 82,265,723 (GRCm39) missense not run
R7706:Irs1 UTSW 1 82,265,412 (GRCm39) missense probably damaging 1.00
R7910:Irs1 UTSW 1 82,267,802 (GRCm39) missense probably benign 0.06
R7912:Irs1 UTSW 1 82,267,605 (GRCm39) missense probably benign
R7962:Irs1 UTSW 1 82,266,443 (GRCm39) missense possibly damaging 0.57
R8139:Irs1 UTSW 1 82,267,460 (GRCm39) missense probably damaging 1.00
R8158:Irs1 UTSW 1 82,267,254 (GRCm39) missense probably damaging 1.00
R8159:Irs1 UTSW 1 82,266,290 (GRCm39) missense probably damaging 1.00
R8187:Irs1 UTSW 1 82,266,021 (GRCm39) missense probably damaging 1.00
R8288:Irs1 UTSW 1 82,265,682 (GRCm39) nonsense probably null
R8436:Irs1 UTSW 1 82,267,970 (GRCm39) missense possibly damaging 0.96
R8865:Irs1 UTSW 1 82,265,830 (GRCm39) nonsense probably null
R8950:Irs1 UTSW 1 82,264,652 (GRCm39) missense probably benign
R9591:Irs1 UTSW 1 82,265,969 (GRCm39) missense probably benign 0.00
X0063:Irs1 UTSW 1 82,266,629 (GRCm39) missense probably damaging 1.00
X0065:Irs1 UTSW 1 82,267,086 (GRCm39) missense probably damaging 1.00
Z1177:Irs1 UTSW 1 82,268,115 (GRCm39) missense probably benign 0.29
Z1177:Irs1 UTSW 1 82,266,717 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACGCTATTGACGATCCTCTG -3'
(R):5'- GAGACCTTCTCAGCACCTACTC -3'

Sequencing Primer
(F):5'- ATCCTCTGGCTGCTTCTGGAAG -3'
(R):5'- AATACGGTGCCCTTTGGAGC -3'
Posted On 2016-06-06