Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:Trpm8'

391672

Institutional Source

Beutler Lab

Gene Symbol

Trpm8

Ensembl Gene

ENSMUSG00000036251

Gene Name

transient receptor potential cation channel, subfamily M, member 8

Synonyms

CMR1, Trp-p8, TRPP8

MMRRC Submission

042622-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.280) question?

Stock #

R5031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88277661-88389293 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88348188 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 503 (T503A)

Ref Sequence

ENSEMBL: ENSMUSP00000131209 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040210] [ENSMUST00000113114] [ENSMUST00000171176]

AlphaFold

Q8R4D5

Predicted Effect

probably benign
Transcript: ENSMUST00000040210
AA Change: T503A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000036991
Gene: ENSMUSG00000036251
AA Change: T503A

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
transmembrane domain	693	712	N/A	INTRINSIC
transmembrane domain	724	758	N/A	INTRINSIC
Pfam:Ion_trans	769	979	4.7e-10	PFAM
low complexity region	1026	1036	N/A	INTRINSIC
coiled coil region	1069	1104	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113114
AA Change: T503A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000108739
Gene: ENSMUSG00000036251
AA Change: T503A

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
transmembrane domain	693	712	N/A	INTRINSIC
transmembrane domain	724	758	N/A	INTRINSIC
Pfam:Ion_trans	769	979	4.7e-10	PFAM
low complexity region	1026	1036	N/A	INTRINSIC
coiled coil region	1069	1104	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147594

Predicted Effect

probably benign
Transcript: ENSMUST00000171176
AA Change: T503A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000131209
Gene: ENSMUSG00000036251
AA Change: T503A

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
transmembrane domain	693	712	N/A	INTRINSIC
transmembrane domain	724	758	N/A	INTRINSIC
transmembrane domain	763	780	N/A	INTRINSIC
transmembrane domain	793	815	N/A	INTRINSIC
transmembrane domain	825	847	N/A	INTRINSIC
transmembrane domain	867	889	N/A	INTRINSIC
transmembrane domain	954	976	N/A	INTRINSIC
low complexity region	1026	1036	N/A	INTRINSIC
coiled coil region	1069	1104	N/A	INTRINSIC

Meta Mutation Damage Score

0.1449

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to cold and reduced response to cold stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,664,514	N136S	probably damaging	Het
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
Atr	A	G	9: 95,865,702	K346E	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Baz2b	T	C	2: 59,912,807	R1607G	probably benign	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Dock1	A	G	7: 135,152,246	D1584G	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gsap	G	A	5: 21,242,826	S294N	possibly damaging	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Irs1	A	T	1: 82,286,967	L1176*	probably null	Het
Klhl29	C	T	12: 5,091,334	R550Q	probably benign	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Magel2	T	C	7: 62,380,104	S919P	unknown	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Pik3cb	C	T	9: 99,071,408	D441N	probably damaging	Het
Qrich1	C	T	9: 108,541,736	P464S	possibly damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tram1l1	T	A	3: 124,321,644	L151*	probably null	Het
Trappc12	T	A	12: 28,692,513	I682L	possibly damaging	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Virma	T	A	4: 11,542,116	Y1567*	probably null	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in Trpm8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00963:Trpm8	APN	1	88379827	missense	possibly damaging	0.82
IGL01387:Trpm8	APN	1	88343287	missense	probably damaging	1.00
IGL01933:Trpm8	APN	1	88326405	missense	probably damaging	0.98
IGL02075:Trpm8	APN	1	88325488	missense	probably damaging	1.00
IGL02184:Trpm8	APN	1	88330694	critical splice acceptor site	probably null
IGL02342:Trpm8	APN	1	88328250	missense	possibly damaging	0.58
IGL02416:Trpm8	APN	1	88360716	missense	probably damaging	1.00
IGL02696:Trpm8	APN	1	88348051	missense	probably damaging	1.00
IGL02807:Trpm8	APN	1	88348108	missense	probably damaging	1.00
R0078:Trpm8	UTSW	1	88328148	splice site	probably benign
R1183:Trpm8	UTSW	1	88348091	missense	probably damaging	1.00
R1608:Trpm8	UTSW	1	88326432	missense	probably benign
R1713:Trpm8	UTSW	1	88365080	missense	probably damaging	1.00
R1724:Trpm8	UTSW	1	88350856	missense	possibly damaging	0.86
R1966:Trpm8	UTSW	1	88332748	splice site	probably null
R2089:Trpm8	UTSW	1	88343326	missense	probably damaging	0.99
R2091:Trpm8	UTSW	1	88343326	missense	probably damaging	0.99
R2091:Trpm8	UTSW	1	88343326	missense	probably damaging	0.99
R2384:Trpm8	UTSW	1	88359656	missense	probably benign	0.00
R2475:Trpm8	UTSW	1	88354449	missense	probably damaging	1.00
R3726:Trpm8	UTSW	1	88328196	missense	probably benign	0.00
R3745:Trpm8	UTSW	1	88348327	missense	probably benign	0.21
R4063:Trpm8	UTSW	1	88362005	missense	probably damaging	1.00
R4678:Trpm8	UTSW	1	88337129	missense	probably benign	0.07
R4681:Trpm8	UTSW	1	88384705	missense	possibly damaging	0.63
R5620:Trpm8	UTSW	1	88359651	critical splice acceptor site	probably null
R5644:Trpm8	UTSW	1	88359739	missense	possibly damaging	0.54
R5734:Trpm8	UTSW	1	88355280	missense	probably benign	0.01
R5839:Trpm8	UTSW	1	88325506	missense	possibly damaging	0.57
R5844:Trpm8	UTSW	1	88384711	makesense	probably null
R5845:Trpm8	UTSW	1	88328180	missense	probably benign	0.00
R5926:Trpm8	UTSW	1	88330747	missense	probably damaging	0.99
R5940:Trpm8	UTSW	1	88351415	nonsense	probably null
R6031:Trpm8	UTSW	1	88354469	missense	possibly damaging	0.95
R6031:Trpm8	UTSW	1	88354469	missense	possibly damaging	0.95
R6088:Trpm8	UTSW	1	88306678	start gained	probably benign
R6283:Trpm8	UTSW	1	88348332	missense	probably benign	0.09
R6299:Trpm8	UTSW	1	88354479	missense	probably damaging	1.00
R6367:Trpm8	UTSW	1	88359683	missense	probably damaging	1.00
R6526:Trpm8	UTSW	1	88361998	missense	probably damaging	0.98
R6682:Trpm8	UTSW	1	88326502	missense	probably damaging	0.96
R6751:Trpm8	UTSW	1	88384706	missense	possibly damaging	0.63
R7057:Trpm8	UTSW	1	88362080	missense	probably null	0.99
R7489:Trpm8	UTSW	1	88379759	missense	possibly damaging	0.85
R7520:Trpm8	UTSW	1	88343321	missense	probably benign	0.00
R7597:Trpm8	UTSW	1	88328196	missense	probably damaging	0.97
R7774:Trpm8	UTSW	1	88330841	missense	probably damaging	0.99
R7839:Trpm8	UTSW	1	88326454	missense	possibly damaging	0.83
R7948:Trpm8	UTSW	1	88374369	nonsense	probably null
R8176:Trpm8	UTSW	1	88365115	missense	probably benign	0.06
R8222:Trpm8	UTSW	1	88325668	splice site	probably null
R8946:Trpm8	UTSW	1	88348339	splice site	probably benign
R9121:Trpm8	UTSW	1	88384701	missense	probably benign	0.17
R9290:Trpm8	UTSW	1	88319045	missense	probably damaging	1.00
R9564:Trpm8	UTSW	1	88326436	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- GCCTTGTGGTATGAGCTCTC -3'
(R):5'- AGCTGCTTTATGGCAATGGG -3'

Sequencing Primer
(F):5'- TGTGGTATGAGCTCTCCTCTC -3'
(R):5'- TGGCGGTAGAGAACTGAATTC -3'

Posted On

2016-06-06