Incidental Mutation 'R5031:Kyat1'
ID391676
Institutional Source Beutler Lab
Gene Symbol Kyat1
Ensembl Gene ENSMUSG00000039648
Gene Namekynurenine aminotransferase 1
SynonymsKat1, 2010009K05Rik, Ccbl1, KATI, cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)
MMRRC Submission 042622-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.547) question?
Stock #R5031 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30185124-30205847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30188090 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 134 (M134T)
Ref Sequence ENSEMBL: ENSMUSP00000109293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044038] [ENSMUST00000113659] [ENSMUST00000113660] [ENSMUST00000113661] [ENSMUST00000113662] [ENSMUST00000113663]
Predicted Effect probably damaging
Transcript: ENSMUST00000044038
AA Change: M134T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038612
Gene: ENSMUSG00000039648
AA Change: M134T

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113659
AA Change: M84T

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109289
Gene: ENSMUSG00000039648
AA Change: M84T

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 53 365 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113660
AA Change: M134T

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109290
Gene: ENSMUSG00000039648
AA Change: M134T

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 145 1.7e-12 PFAM
Pfam:Aminotran_1_2 146 372 1e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113661
AA Change: M134T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109291
Gene: ENSMUSG00000039648
AA Change: M134T

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Pfam:DegT_DnrJ_EryC1 80 214 3.7e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113662
AA Change: M134T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109292
Gene: ENSMUSG00000039648
AA Change: M134T

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Pfam:DegT_DnrJ_EryC1 80 214 3.7e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113663
AA Change: M134T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109293
Gene: ENSMUSG00000039648
AA Change: M134T

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Pfam:DegT_DnrJ_EryC1 80 214 3.7e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149522
Meta Mutation Damage Score 0.7752 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme that is responsible for the metabolism of cysteine conjugates of certain halogenated alkenes and alkanes. This metabolism can form reactive metabolites leading to nephrotoxicity and neurotoxicity. Increased levels of this enzyme have been linked to schizophrenia. Multiple transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,664,514 N136S probably damaging Het
Abca13 A T 11: 9,297,678 N2475I probably damaging Het
Acnat2 T C 4: 49,380,631 K231R probably damaging Het
Ank1 C T 8: 23,099,680 P599L probably damaging Het
Arhgef19 A G 4: 141,250,810 E580G probably damaging Het
Atr A G 9: 95,865,702 K346E probably damaging Het
AU021092 T C 16: 5,212,604 K309E probably damaging Het
Baz2b T C 2: 59,912,807 R1607G probably benign Het
Cct8 C T 16: 87,487,538 V254M probably damaging Het
Cdca2 T A 14: 67,713,153 I110F probably damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Dmkn A G 7: 30,764,236 I105V probably benign Het
Dock1 A G 7: 135,152,246 D1584G probably benign Het
Epg5 G A 18: 78,028,948 V2392I probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsap G A 5: 21,242,826 S294N possibly damaging Het
Hectd2 A G 19: 36,599,604 N142D probably damaging Het
Hmcn1 A G 1: 150,588,257 C5091R probably damaging Het
Ifitm5 G A 7: 140,950,104 R36* probably null Het
Ints2 G A 11: 86,256,200 P40L probably damaging Het
Irs1 A T 1: 82,286,967 L1176* probably null Het
Klhl29 C T 12: 5,091,334 R550Q probably benign Het
Lrrk2 A T 15: 91,700,619 N384Y possibly damaging Het
Magel2 T C 7: 62,380,104 S919P unknown Het
Mettl16 A T 11: 74,802,999 I279F probably benign Het
Mrgpra1 A T 7: 47,335,237 Y231* probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mut T C 17: 40,938,827 F231S possibly damaging Het
Mvp A C 7: 126,993,616 Y374* probably null Het
Nabp2 G A 10: 128,409,628 probably benign Het
Nos1 C T 5: 117,879,313 P247L probably benign Het
Olfr1015 T A 2: 85,785,718 L69* probably null Het
Olfr1115 C A 2: 87,252,082 F48L probably benign Het
Pik3cb C T 9: 99,071,408 D441N probably damaging Het
Qrich1 C T 9: 108,541,736 P464S possibly damaging Het
Rab17 A T 1: 90,960,138 probably null Het
Rspo3 A T 10: 29,506,447 L77H probably damaging Het
Spn G T 7: 127,137,230 T35K probably benign Het
Sult1d1 T A 5: 87,559,844 Y139F possibly damaging Het
Tbc1d32 C A 10: 56,123,531 Q848H probably damaging Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tram1l1 T A 3: 124,321,644 L151* probably null Het
Trappc12 T A 12: 28,692,513 I682L possibly damaging Het
Trav6d-4 A C 14: 52,753,599 T31P probably damaging Het
Trpm8 A G 1: 88,348,188 T503A probably benign Het
Virma T A 4: 11,542,116 Y1567* probably null Het
Vmn1r228 T A 17: 20,776,681 K192* probably null Het
Zfp521 T A 18: 13,844,273 T1028S possibly damaging Het
Zfp583 T A 7: 6,317,398 Q205L probably benign Het
Other mutations in Kyat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Kyat1 APN 2 30185553 missense probably benign 0.00
IGL02216:Kyat1 APN 2 30187252 missense probably benign 0.44
IGL02864:Kyat1 APN 2 30192077 splice site probably benign
IGL02975:Kyat1 APN 2 30186675 missense probably damaging 0.99
R0193:Kyat1 UTSW 2 30187186 critical splice donor site probably null
R0230:Kyat1 UTSW 2 30194075 missense probably benign
R0539:Kyat1 UTSW 2 30188217 missense probably damaging 1.00
R2483:Kyat1 UTSW 2 30186698 missense possibly damaging 0.71
R3935:Kyat1 UTSW 2 30185749 missense probably damaging 1.00
R4651:Kyat1 UTSW 2 30194064 missense probably benign 0.00
R4685:Kyat1 UTSW 2 30188265 missense probably damaging 1.00
R5699:Kyat1 UTSW 2 30186650 missense probably benign 0.01
R5722:Kyat1 UTSW 2 30188111 missense probably damaging 1.00
R7299:Kyat1 UTSW 2 30191995 missense probably benign 0.02
R8000:Kyat1 UTSW 2 30192053 missense probably benign
R8231:Kyat1 UTSW 2 30191966 missense probably benign 0.00
Z1176:Kyat1 UTSW 2 30187732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTGCCAATCATTGCTGG -3'
(R):5'- TATGGGGCCTTGTTCACAGC -3'

Sequencing Primer
(F):5'- GGGAGCAGTATTTACTTTCCTGACC -3'
(R):5'- GGCCTTGTTCACAGCCTTTCAG -3'
Posted On2016-06-06