Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:Baz2b'

391677

Institutional Source

Beutler Lab

Gene Symbol

Baz2b

Ensembl Gene

ENSMUSG00000026987

Gene Name

bromodomain adjacent to zinc finger domain, 2B

Synonyms

D2Ertd794e, 5830435C13Rik

MMRRC Submission

042622-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.307) question?

Stock #

R5031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59899363-60209839 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59912807 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 1607 (R1607G)

Ref Sequence

ENSEMBL: ENSMUSP00000108169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]

AlphaFold

A2AUY4

Predicted Effect

probably benign
Transcript: ENSMUST00000090925
AA Change: R1607G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: R1607G

Domain	Start	End	E-Value	Type
low complexity region	7	46	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
low complexity region	147	162	N/A	INTRINSIC
low complexity region	193	244	N/A	INTRINSIC
low complexity region	291	308	N/A	INTRINSIC
low complexity region	366	385	N/A	INTRINSIC
low complexity region	528	540	N/A	INTRINSIC
low complexity region	554	614	N/A	INTRINSIC
low complexity region	628	637	N/A	INTRINSIC
low complexity region	671	685	N/A	INTRINSIC
Pfam:MBD	690	742	1e-12	PFAM
low complexity region	759	774	N/A	INTRINSIC
coiled coil region	814	975	N/A	INTRINSIC
DDT	1004	1069	1.19e-20	SMART
low complexity region	1199	1212	N/A	INTRINSIC
low complexity region	1213	1247	N/A	INTRINSIC
coiled coil region	1251	1286	N/A	INTRINSIC
low complexity region	1320	1337	N/A	INTRINSIC
low complexity region	1503	1524	N/A	INTRINSIC
low complexity region	1569	1582	N/A	INTRINSIC
low complexity region	1585	1605	N/A	INTRINSIC
Blast:BROMO	1802	1843	7e-18	BLAST
PHD	1888	1934	1.71e-12	SMART
low complexity region	1942	1964	N/A	INTRINSIC
low complexity region	1968	1980	N/A	INTRINSIC
BROMO	2013	2121	3.85e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112550
AA Change: R1607G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: R1607G

Domain	Start	End	E-Value	Type
low complexity region	7	46	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
low complexity region	147	162	N/A	INTRINSIC
low complexity region	193	244	N/A	INTRINSIC
low complexity region	291	308	N/A	INTRINSIC
low complexity region	366	385	N/A	INTRINSIC
low complexity region	528	540	N/A	INTRINSIC
low complexity region	554	614	N/A	INTRINSIC
low complexity region	628	637	N/A	INTRINSIC
low complexity region	671	685	N/A	INTRINSIC
Pfam:MBD	690	741	3.4e-13	PFAM
low complexity region	759	774	N/A	INTRINSIC
coiled coil region	814	975	N/A	INTRINSIC
DDT	1004	1069	1.19e-20	SMART
low complexity region	1199	1212	N/A	INTRINSIC
low complexity region	1213	1247	N/A	INTRINSIC
coiled coil region	1251	1286	N/A	INTRINSIC
low complexity region	1320	1337	N/A	INTRINSIC
low complexity region	1503	1524	N/A	INTRINSIC
low complexity region	1569	1582	N/A	INTRINSIC
low complexity region	1585	1605	N/A	INTRINSIC
Pfam:WHIM3	1638	1676	5.1e-14	PFAM
Blast:BROMO	1802	1843	7e-18	BLAST
PHD	1888	1934	1.71e-12	SMART
low complexity region	1942	1964	N/A	INTRINSIC
low complexity region	1968	1980	N/A	INTRINSIC
BROMO	2013	2121	3.85e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130637

SMART Domains

Protein: ENSMUSP00000119690
Gene: ENSMUSG00000026987

Domain	Start	End	E-Value	Type
Pfam:WHIM3	2	37	1.8e-13	PFAM
low complexity region	162	173	N/A	INTRINSIC
PHD	214	253	2.05e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147476

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152639

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,664,514	N136S	probably damaging	Het
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
Atr	A	G	9: 95,865,702	K346E	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Dock1	A	G	7: 135,152,246	D1584G	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gsap	G	A	5: 21,242,826	S294N	possibly damaging	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Irs1	A	T	1: 82,286,967	L1176*	probably null	Het
Klhl29	C	T	12: 5,091,334	R550Q	probably benign	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Magel2	T	C	7: 62,380,104	S919P	unknown	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Pik3cb	C	T	9: 99,071,408	D441N	probably damaging	Het
Qrich1	C	T	9: 108,541,736	P464S	possibly damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tram1l1	T	A	3: 124,321,644	L151*	probably null	Het
Trappc12	T	A	12: 28,692,513	I682L	possibly damaging	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Trpm8	A	G	1: 88,348,188	T503A	probably benign	Het
Virma	T	A	4: 11,542,116	Y1567*	probably null	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in Baz2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Baz2b	APN	2	59912795	missense	probably benign	0.02
IGL00476:Baz2b	APN	2	59913739	missense	probably benign	0.06
IGL00489:Baz2b	APN	2	59957675	nonsense	probably null
IGL00514:Baz2b	APN	2	59962477	missense	probably benign	0.11
IGL00678:Baz2b	APN	2	60006183	missense	unknown
IGL01348:Baz2b	APN	2	59933687	missense	possibly damaging	0.95
IGL01354:Baz2b	APN	2	59968889	missense	probably benign	0.18
IGL01924:Baz2b	APN	2	59935271	missense	probably damaging	1.00
IGL02125:Baz2b	APN	2	59968640	missense	probably benign	0.12
IGL02314:Baz2b	APN	2	59962227	missense	probably benign
IGL02370:Baz2b	APN	2	59923589	missense	possibly damaging	0.77
IGL02473:Baz2b	APN	2	59960063	missense	probably benign	0.40
IGL02499:Baz2b	APN	2	59901496	missense	possibly damaging	0.60
IGL02609:Baz2b	APN	2	59917369	missense	possibly damaging	0.77
IGL02705:Baz2b	APN	2	59948260	missense	possibly damaging	0.92
IGL02711:Baz2b	APN	2	59917505	unclassified	probably benign
IGL02716:Baz2b	APN	2	59962524	missense	possibly damaging	0.53
IGL02724:Baz2b	APN	2	59977374	missense	possibly damaging	0.70
IGL02750:Baz2b	APN	2	59968658	missense	possibly damaging	0.73
IGL02869:Baz2b	APN	2	59977528	missense	probably benign	0.00
IGL02886:Baz2b	APN	2	59957743	splice site	probably null
IGL02892:Baz2b	APN	2	59900736	missense	probably damaging	1.00
IGL03132:Baz2b	APN	2	59907753	splice site	probably benign
IGL03183:Baz2b	APN	2	59903296	missense	probably benign	0.10
IGL03197:Baz2b	APN	2	59901554	missense	possibly damaging	0.74
R0054:Baz2b	UTSW	2	59932166	missense	probably damaging	1.00
R0054:Baz2b	UTSW	2	59932166	missense	probably damaging	1.00
R0122:Baz2b	UTSW	2	59913619	splice site	probably null
R0136:Baz2b	UTSW	2	59901954	missense	probably benign	0.22
R0144:Baz2b	UTSW	2	59907495	missense	probably damaging	0.98
R0403:Baz2b	UTSW	2	59969377	missense	possibly damaging	0.70
R0498:Baz2b	UTSW	2	59901996	unclassified	probably benign
R0528:Baz2b	UTSW	2	59936739	missense	probably damaging	1.00
R1025:Baz2b	UTSW	2	59962482	missense	probably benign	0.06
R1470:Baz2b	UTSW	2	59978546	missense	possibly damaging	0.53
R1470:Baz2b	UTSW	2	59978546	missense	possibly damaging	0.53
R1510:Baz2b	UTSW	2	59922209	missense	probably damaging	1.00
R1511:Baz2b	UTSW	2	59962024	missense	probably benign	0.12
R1514:Baz2b	UTSW	2	59962326	missense	probably benign	0.13
R1519:Baz2b	UTSW	2	59948254	missense	possibly damaging	0.50
R1523:Baz2b	UTSW	2	59968637	missense	possibly damaging	0.47
R1630:Baz2b	UTSW	2	60006130	missense	unknown
R1641:Baz2b	UTSW	2	59912890	missense	probably damaging	0.99
R1674:Baz2b	UTSW	2	59912992	missense	possibly damaging	0.53
R1778:Baz2b	UTSW	2	60006136	missense	unknown
R1826:Baz2b	UTSW	2	59968733	missense	probably benign	0.12
R1835:Baz2b	UTSW	2	59901819	missense	probably benign	0.02
R1954:Baz2b	UTSW	2	59968743	missense	probably benign	0.12
R1981:Baz2b	UTSW	2	59923680	missense	possibly damaging	0.95
R2029:Baz2b	UTSW	2	59912723	unclassified	probably benign
R2567:Baz2b	UTSW	2	59913911	missense	possibly damaging	0.82
R2842:Baz2b	UTSW	2	59913004	missense	probably benign	0.27
R2848:Baz2b	UTSW	2	59924666	missense	possibly damaging	0.64
R3809:Baz2b	UTSW	2	59968896	missense	probably benign	0.12
R3935:Baz2b	UTSW	2	59912761	missense	possibly damaging	0.81
R3936:Baz2b	UTSW	2	59912761	missense	possibly damaging	0.81
R4072:Baz2b	UTSW	2	59912573	splice site	probably null
R4182:Baz2b	UTSW	2	60098457	intron	probably benign
R4255:Baz2b	UTSW	2	59920572	unclassified	probably benign
R4359:Baz2b	UTSW	2	59901613	missense	possibly damaging	0.87
R4716:Baz2b	UTSW	2	59969255	missense	probably benign	0.06
R4743:Baz2b	UTSW	2	59913911	missense	probably benign	0.01
R4772:Baz2b	UTSW	2	59958451	missense	probably damaging	0.96
R4858:Baz2b	UTSW	2	59907743	missense	probably benign
R4868:Baz2b	UTSW	2	59924882	missense	possibly damaging	0.65
R4872:Baz2b	UTSW	2	59942759	splice site	probably null
R4889:Baz2b	UTSW	2	59936726	missense	probably damaging	1.00
R4890:Baz2b	UTSW	2	59926039	missense	probably damaging	0.99
R4914:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R4915:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R4918:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R5027:Baz2b	UTSW	2	60098644	intron	probably benign
R5082:Baz2b	UTSW	2	59901491	nonsense	probably null
R5133:Baz2b	UTSW	2	59962024	missense	probably benign	0.12
R5276:Baz2b	UTSW	2	59962614	missense	probably benign	0.40
R5279:Baz2b	UTSW	2	59932152	missense	probably damaging	1.00
R5294:Baz2b	UTSW	2	59978602	missense	probably benign	0.11
R5447:Baz2b	UTSW	2	59913988	missense	probably damaging	0.99
R5903:Baz2b	UTSW	2	59959889	missense	probably damaging	0.99
R5910:Baz2b	UTSW	2	59977426	missense	possibly damaging	0.88
R6140:Baz2b	UTSW	2	59912527	missense	probably damaging	0.99
R6195:Baz2b	UTSW	2	59907511	missense	possibly damaging	0.89
R6199:Baz2b	UTSW	2	59978675	missense	probably benign	0.00
R6208:Baz2b	UTSW	2	59924806	missense	probably damaging	1.00
R6233:Baz2b	UTSW	2	59907511	missense	possibly damaging	0.89
R6276:Baz2b	UTSW	2	59948223	missense	probably damaging	1.00
R6324:Baz2b	UTSW	2	59906948	missense	probably damaging	1.00
R6490:Baz2b	UTSW	2	59901729	missense	probably damaging	1.00
R6578:Baz2b	UTSW	2	59969279	missense	possibly damaging	0.47
R6720:Baz2b	UTSW	2	59924890	missense	probably damaging	1.00
R6760:Baz2b	UTSW	2	59962432	missense	probably benign	0.40
R6836:Baz2b	UTSW	2	59917425	missense	probably damaging	1.00
R6859:Baz2b	UTSW	2	59901530	missense	probably benign	0.01
R6880:Baz2b	UTSW	2	59912939	missense	probably damaging	0.99
R6916:Baz2b	UTSW	2	59968776	missense	probably benign
R6978:Baz2b	UTSW	2	59907715	missense	possibly damaging	0.84
R7037:Baz2b	UTSW	2	59933670	critical splice donor site	probably null
R7112:Baz2b	UTSW	2	59962184	missense	possibly damaging	0.53
R7117:Baz2b	UTSW	2	59912497	missense
R7198:Baz2b	UTSW	2	59962206	missense	probably benign	0.00
R7270:Baz2b	UTSW	2	59962492	missense	possibly damaging	0.96
R7282:Baz2b	UTSW	2	59920437	missense	probably benign	0.17
R7464:Baz2b	UTSW	2	59977448	missense	possibly damaging	0.53
R7609:Baz2b	UTSW	2	59962473	missense	probably benign	0.40
R7703:Baz2b	UTSW	2	59917425	missense	probably damaging	1.00
R7850:Baz2b	UTSW	2	59936716	missense	probably damaging	0.98
R7851:Baz2b	UTSW	2	59936716	missense	probably damaging	0.98
R7988:Baz2b	UTSW	2	59962141	missense	possibly damaging	0.53
R8079:Baz2b	UTSW	2	59900768	missense	probably damaging	1.00
R8084:Baz2b	UTSW	2	59962236	missense	probably benign
R8343:Baz2b	UTSW	2	59901514	missense	probably damaging	1.00
R8348:Baz2b	UTSW	2	59911793	missense
R8438:Baz2b	UTSW	2	59917484	nonsense	probably null
R8448:Baz2b	UTSW	2	59911793	missense
R8511:Baz2b	UTSW	2	59901814	missense	probably benign
R8893:Baz2b	UTSW	2	59924805	missense	probably damaging	0.96
R8947:Baz2b	UTSW	2	59948239	missense	probably benign	0.06
R8998:Baz2b	UTSW	2	59969264	missense	probably benign	0.02
R9241:Baz2b	UTSW	2	59913649	missense	probably benign	0.01
R9245:Baz2b	UTSW	2	59912987	missense	probably benign
R9577:Baz2b	UTSW	2	59978687	missense	probably benign	0.06
R9581:Baz2b	UTSW	2	59968956	missense	probably benign
R9601:Baz2b	UTSW	2	59901503	missense	possibly damaging	0.66
R9613:Baz2b	UTSW	2	59901480	missense	probably benign	0.09
R9639:Baz2b	UTSW	2	59901484	missense	probably benign	0.01
X0011:Baz2b	UTSW	2	59977361	missense	possibly damaging	0.53
X0053:Baz2b	UTSW	2	59900675	missense	probably damaging	1.00
X0064:Baz2b	UTSW	2	59969282	missense	probably benign
Z1088:Baz2b	UTSW	2	59960015	missense	probably damaging	1.00
Z1177:Baz2b	UTSW	2	59977520	missense	probably benign	0.01
Z1188:Baz2b	UTSW	2	59977405	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGGCATTAAGGAAATCTCAGGAT -3'
(R):5'- CAGGTGAAAGGTGGTGTGTC -3'

Sequencing Primer
(F):5'- TTTGTTAGCTACACAAATCCATCGG -3'
(R):5'- TGTCTATGATGGGACTTCAGTTC -3'

Posted On

2016-06-06