Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:Virma'

391681

Institutional Source

Beutler Lab

Gene Symbol

Virma

Ensembl Gene

ENSMUSG00000040720

Gene Name

vir like m6A methyltransferase associated

Synonyms

1110037F02Rik

MMRRC Submission

042622-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11485958-11550684 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 11542116 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1567 (Y1567*)

Ref Sequence

ENSEMBL: ENSMUSP00000103943 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059914] [ENSMUST00000108307]

AlphaFold

A2AIV2

Predicted Effect

probably null
Transcript: ENSMUST00000059914
AA Change: Y1517*

SMART Domains

Protein: ENSMUSP00000058078
Gene: ENSMUSG00000040720
AA Change: Y1517*

Domain	Start	End	E-Value	Type
low complexity region	139	153	N/A	INTRINSIC
low complexity region	172	198	N/A	INTRINSIC
low complexity region	236	267	N/A	INTRINSIC
low complexity region	276	297	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
low complexity region	1008	1020	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1224	1232	N/A	INTRINSIC
low complexity region	1443	1458	N/A	INTRINSIC
low complexity region	1460	1474	N/A	INTRINSIC
low complexity region	1618	1634	N/A	INTRINSIC
low complexity region	1684	1697	N/A	INTRINSIC
low complexity region	1750	1757	N/A	INTRINSIC
low complexity region	1796	1808	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108307
AA Change: Y1567*

SMART Domains

Protein: ENSMUSP00000103943
Gene: ENSMUSG00000040720
AA Change: Y1567*

Domain	Start	End	E-Value	Type
Pfam:VIR_N	5	266	2e-110	PFAM
low complexity region	276	297	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
low complexity region	1058	1070	N/A	INTRINSIC
low complexity region	1162	1174	N/A	INTRINSIC
low complexity region	1274	1282	N/A	INTRINSIC
low complexity region	1493	1508	N/A	INTRINSIC
low complexity region	1510	1524	N/A	INTRINSIC
low complexity region	1668	1684	N/A	INTRINSIC
low complexity region	1734	1747	N/A	INTRINSIC
low complexity region	1800	1807	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC

Meta Mutation Damage Score

0.9712

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,664,514	N136S	probably damaging	Het
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
Atr	A	G	9: 95,865,702	K346E	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Baz2b	T	C	2: 59,912,807	R1607G	probably benign	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Dock1	A	G	7: 135,152,246	D1584G	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gsap	G	A	5: 21,242,826	S294N	possibly damaging	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Irs1	A	T	1: 82,286,967	L1176*	probably null	Het
Klhl29	C	T	12: 5,091,334	R550Q	probably benign	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Magel2	T	C	7: 62,380,104	S919P	unknown	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Pik3cb	C	T	9: 99,071,408	D441N	probably damaging	Het
Qrich1	C	T	9: 108,541,736	P464S	possibly damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tram1l1	T	A	3: 124,321,644	L151*	probably null	Het
Trappc12	T	A	12: 28,692,513	I682L	possibly damaging	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Trpm8	A	G	1: 88,348,188	T503A	probably benign	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in Virma

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Virma	APN	4	11519424	splice site	probably benign
IGL00477:Virma	APN	4	11519006	missense	probably damaging	0.99
IGL01293:Virma	APN	4	11521114	missense	probably damaging	1.00
IGL01410:Virma	APN	4	11518929	nonsense	probably null
IGL01531:Virma	APN	4	11528753	missense	probably damaging	1.00
IGL01672:Virma	APN	4	11527792	missense	probably damaging	1.00
IGL01724:Virma	APN	4	11528672	missense	probably damaging	1.00
IGL01747:Virma	APN	4	11526877	missense	probably damaging	1.00
IGL01776:Virma	APN	4	11527792	missense	probably damaging	1.00
IGL02064:Virma	APN	4	11513163	missense	possibly damaging	0.87
IGL02243:Virma	APN	4	11546031	missense	probably damaging	1.00
IGL02244:Virma	APN	4	11546031	missense	probably damaging	1.00
IGL02445:Virma	APN	4	11527029	missense	probably damaging	0.97
IGL02546:Virma	APN	4	11494804	missense	probably damaging	0.99
IGL02807:Virma	APN	4	11507079	splice site	probably benign
IGL02967:Virma	APN	4	11514096	missense	probably benign	0.01
IGL03211:Virma	APN	4	11548770	nonsense	probably null
IGL03242:Virma	APN	4	11527669	missense	possibly damaging	0.70
IGL03256:Virma	APN	4	11542207	splice site	probably benign
IGL03327:Virma	APN	4	11518984	missense	probably benign	0.00
IGL03346:Virma	APN	4	11518984	missense	probably benign	0.00
PIT4802001:Virma	UTSW	4	11546008	missense	probably damaging	0.99
R0142:Virma	UTSW	4	11548783	missense	probably benign	0.04
R0355:Virma	UTSW	4	11528626	nonsense	probably null
R0522:Virma	UTSW	4	11519416	critical splice donor site	probably null
R0600:Virma	UTSW	4	11498769	missense	probably damaging	0.99
R1435:Virma	UTSW	4	11528621	missense	probably damaging	1.00
R1489:Virma	UTSW	4	11521164	missense	probably damaging	1.00
R1568:Virma	UTSW	4	11528776	missense	probably damaging	0.99
R1616:Virma	UTSW	4	11544954	missense	probably damaging	1.00
R1655:Virma	UTSW	4	11494786	missense	probably damaging	1.00
R1695:Virma	UTSW	4	11494814	missense	probably damaging	0.98
R1835:Virma	UTSW	4	11540511	missense	probably benign	0.02
R1951:Virma	UTSW	4	11513907	missense	probably benign	0.00
R1991:Virma	UTSW	4	11519242	missense	probably benign	0.06
R2145:Virma	UTSW	4	11548726	splice site	probably benign
R2172:Virma	UTSW	4	11527843	missense	possibly damaging	0.82
R2217:Virma	UTSW	4	11544924	missense	probably damaging	1.00
R2218:Virma	UTSW	4	11544924	missense	probably damaging	1.00
R2248:Virma	UTSW	4	11518927	missense	probably damaging	1.00
R2342:Virma	UTSW	4	11501316	missense	probably damaging	1.00
R3424:Virma	UTSW	4	11513177	nonsense	probably null
R4397:Virma	UTSW	4	11513901	missense	possibly damaging	0.81
R4449:Virma	UTSW	4	11498828	critical splice donor site	probably null
R4660:Virma	UTSW	4	11513505	missense	probably damaging	1.00
R4698:Virma	UTSW	4	11528636	missense	probably damaging	0.99
R4878:Virma	UTSW	4	11544971	missense	probably damaging	1.00
R4937:Virma	UTSW	4	11521147	nonsense	probably null
R5040:Virma	UTSW	4	11528746	missense	probably benign	0.01
R5061:Virma	UTSW	4	11494840	missense	possibly damaging	0.95
R5091:Virma	UTSW	4	11519392	missense	probably benign	0.00
R5137:Virma	UTSW	4	11546297	missense	probably damaging	1.00
R5262:Virma	UTSW	4	11539926	missense	probably benign	0.01
R5297:Virma	UTSW	4	11494819	missense	probably damaging	1.00
R5730:Virma	UTSW	4	11542154	missense	probably benign	0.44
R5818:Virma	UTSW	4	11513319	missense	possibly damaging	0.92
R5835:Virma	UTSW	4	11514036	missense	probably damaging	1.00
R6125:Virma	UTSW	4	11521172	missense	probably damaging	0.98
R6197:Virma	UTSW	4	11505498	missense	probably damaging	0.96
R6222:Virma	UTSW	4	11527820	missense	probably damaging	1.00
R6793:Virma	UTSW	4	11539968	missense	probably damaging	1.00
R7028:Virma	UTSW	4	11519249	missense	possibly damaging	0.50
R7356:Virma	UTSW	4	11513595	missense	probably damaging	0.99
R7383:Virma	UTSW	4	11514026	missense	probably damaging	0.98
R7391:Virma	UTSW	4	11508099	missense	probably damaging	0.99
R7425:Virma	UTSW	4	11546211	missense	possibly damaging	0.95
R7556:Virma	UTSW	4	11518927	missense	probably damaging	1.00
R7715:Virma	UTSW	4	11549682	missense	probably damaging	1.00
R7715:Virma	UTSW	4	11513016	splice site	probably null
R7986:Virma	UTSW	4	11540023	missense	probably benign	0.01
R7990:Virma	UTSW	4	11513983	missense	probably benign	0.00
R8048:Virma	UTSW	4	11539918	nonsense	probably null
R8050:Virma	UTSW	4	11528643	missense	probably benign	0.22
R8165:Virma	UTSW	4	11542128	missense	probably benign	0.00
R8412:Virma	UTSW	4	11521261	critical splice donor site	probably null
R8544:Virma	UTSW	4	11516949	missense	probably benign
R8551:Virma	UTSW	4	11513397	missense	probably damaging	1.00
R8699:Virma	UTSW	4	11528678	missense	probably benign	0.04
R8739:Virma	UTSW	4	11540643	critical splice donor site	probably null
R8950:Virma	UTSW	4	11519047	nonsense	probably null
R9015:Virma	UTSW	4	11540494	missense	probably benign	0.27
R9038:Virma	UTSW	4	11526922	missense	possibly damaging	0.93
R9115:Virma	UTSW	4	11498744	missense	probably benign	0.15
R9294:Virma	UTSW	4	11513507	nonsense	probably null
R9404:Virma	UTSW	4	11513626	missense	probably benign	0.17
R9477:Virma	UTSW	4	11528753	missense	probably damaging	1.00
R9532:Virma	UTSW	4	11507078	critical splice donor site	probably null
R9649:Virma	UTSW	4	11486045	start codon destroyed	probably null	0.08
R9657:Virma	UTSW	4	11544898	missense	probably damaging	0.99
R9780:Virma	UTSW	4	11513442	missense	possibly damaging	0.75
R9800:Virma	UTSW	4	11546007	missense	probably damaging	0.99
X0020:Virma	UTSW	4	11486055	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CACCGGGTTTGTTTTCTGAATC -3'
(R):5'- CAGAGAGAACATGAATTTGTCCTC -3'

Sequencing Primer
(F):5'- CCGGGTTTGTTTTCTGAATCTTTGAC -3'
(R):5'- TCCTCAAATGGACCTGAAGTG -3'

Posted On

2016-06-06