Incidental Mutation 'R5031:Arhgef19'
ID 391683
Institutional Source Beutler Lab
Gene Symbol Arhgef19
Ensembl Gene ENSMUSG00000028919
Gene Name Rho guanine nucleotide exchange factor 19
Synonyms WGEF, 6430573B13Rik
MMRRC Submission 042622-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.247) question?
Stock # R5031 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 140966810-140984875 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 140978121 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 580 (E580G)
Ref Sequence ENSEMBL: ENSMUSP00000006618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006618] [ENSMUST00000125392] [ENSMUST00000135623] [ENSMUST00000138096] [ENSMUST00000141834] [ENSMUST00000147903]
AlphaFold Q8BWA8
Predicted Effect probably damaging
Transcript: ENSMUST00000006618
AA Change: E580G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006618
Gene: ENSMUSG00000028919
AA Change: E580G

DomainStartEndE-ValueType
low complexity region 145 160 N/A INTRINSIC
low complexity region 161 172 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
RhoGEF 380 559 5.51e-43 SMART
PH 593 706 8.86e-6 SMART
SH3 718 775 5.16e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125392
Predicted Effect probably benign
Transcript: ENSMUST00000135623
SMART Domains Protein: ENSMUSP00000119846
Gene: ENSMUSG00000028919

DomainStartEndE-ValueType
low complexity region 145 160 N/A INTRINSIC
low complexity region 161 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140536
SMART Domains Protein: ENSMUSP00000114784
Gene: ENSMUSG00000028919

DomainStartEndE-ValueType
low complexity region 145 160 N/A INTRINSIC
low complexity region 161 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184162
Predicted Effect probably benign
Transcript: ENSMUST00000147903
SMART Domains Protein: ENSMUSP00000120088
Gene: ENSMUSG00000028919

DomainStartEndE-ValueType
low complexity region 147 173 N/A INTRINSIC
Meta Mutation Damage Score 0.2754 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide exchange factors (GEFs) such as ARHGEF19 accelerate the GTPase activity of Rho GTPases (see RHOA, MIM 165390).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,247,678 (GRCm39) N2475I probably damaging Het
Acnat2 T C 4: 49,380,631 (GRCm39) K231R probably damaging Het
Ank1 C T 8: 23,589,696 (GRCm39) P599L probably damaging Het
Atr A G 9: 95,747,755 (GRCm39) K346E probably damaging Het
AU021092 T C 16: 5,030,468 (GRCm39) K309E probably damaging Het
Baz2b T C 2: 59,743,151 (GRCm39) R1607G probably benign Het
Cct8 C T 16: 87,284,426 (GRCm39) V254M probably damaging Het
Cdca2 T A 14: 67,950,602 (GRCm39) I110F probably damaging Het
Csmd3 A T 15: 47,522,588 (GRCm39) C2694S probably damaging Het
Dmkn A G 7: 30,463,661 (GRCm39) I105V probably benign Het
Dock1 A G 7: 134,753,975 (GRCm39) D1584G probably benign Het
Epg5 G A 18: 78,072,163 (GRCm39) V2392I probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Gsap G A 5: 21,447,824 (GRCm39) S294N possibly damaging Het
Hectd2 A G 19: 36,577,004 (GRCm39) N142D probably damaging Het
Hmcn1 A G 1: 150,464,008 (GRCm39) C5091R probably damaging Het
Ifitm5 G A 7: 140,530,017 (GRCm39) R36* probably null Het
Ints2 G A 11: 86,147,026 (GRCm39) P40L probably damaging Het
Irs1 A T 1: 82,264,688 (GRCm39) L1176* probably null Het
Klhl29 C T 12: 5,141,334 (GRCm39) R550Q probably benign Het
Kyat1 A G 2: 30,078,102 (GRCm39) M134T probably damaging Het
Lrrk2 A T 15: 91,584,822 (GRCm39) N384Y possibly damaging Het
Magel2 T C 7: 62,029,852 (GRCm39) S919P unknown Het
Mettl16 A T 11: 74,693,825 (GRCm39) I279F probably benign Het
Mmut T C 17: 41,249,718 (GRCm39) F231S possibly damaging Het
Mrgpra1 A T 7: 46,984,985 (GRCm39) Y231* probably null Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Mvp A C 7: 126,592,788 (GRCm39) Y374* probably null Het
Nabp2 G A 10: 128,245,497 (GRCm39) probably benign Het
Nos1 C T 5: 118,017,378 (GRCm39) P247L probably benign Het
Or10ag53 C A 2: 87,082,426 (GRCm39) F48L probably benign Het
Or9g4b T A 2: 85,616,062 (GRCm39) L69* probably null Het
Pik3cb C T 9: 98,953,461 (GRCm39) D441N probably damaging Het
Qrich1 C T 9: 108,418,935 (GRCm39) P464S possibly damaging Het
Rab17 A T 1: 90,887,860 (GRCm39) probably null Het
Relch A G 1: 105,592,239 (GRCm39) N136S probably damaging Het
Rspo3 A T 10: 29,382,443 (GRCm39) L77H probably damaging Het
Spn G T 7: 126,736,402 (GRCm39) T35K probably benign Het
Sult1d1 T A 5: 87,707,703 (GRCm39) Y139F possibly damaging Het
Tbc1d32 C A 10: 55,999,627 (GRCm39) Q848H probably damaging Het
Tcaf3 A G 6: 42,573,867 (GRCm39) V115A probably benign Het
Tram1l1 T A 3: 124,115,293 (GRCm39) L151* probably null Het
Trappc12 T A 12: 28,742,512 (GRCm39) I682L possibly damaging Het
Trav6d-4 A C 14: 52,991,056 (GRCm39) T31P probably damaging Het
Trpm8 A G 1: 88,275,910 (GRCm39) T503A probably benign Het
Virma T A 4: 11,542,116 (GRCm39) Y1567* probably null Het
Vmn1r228 T A 17: 20,996,943 (GRCm39) K192* probably null Het
Zfp521 T A 18: 13,977,330 (GRCm39) T1028S possibly damaging Het
Zfp583 T A 7: 6,320,397 (GRCm39) Q205L probably benign Het
Other mutations in Arhgef19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Arhgef19 APN 4 140,976,294 (GRCm39) unclassified probably benign
IGL02037:Arhgef19 APN 4 140,973,707 (GRCm39) missense probably damaging 0.99
IGL03049:Arhgef19 APN 4 140,981,627 (GRCm39) missense probably damaging 0.98
IGL03071:Arhgef19 APN 4 140,976,313 (GRCm39) missense possibly damaging 0.88
IGL03098:Arhgef19 UTSW 4 140,974,879 (GRCm39) missense possibly damaging 0.85
R0271:Arhgef19 UTSW 4 140,977,918 (GRCm39) missense probably benign 0.00
R0319:Arhgef19 UTSW 4 140,983,710 (GRCm39) missense possibly damaging 0.63
R1572:Arhgef19 UTSW 4 140,982,065 (GRCm39) missense probably benign 0.10
R1633:Arhgef19 UTSW 4 140,965,871 (GRCm39) unclassified probably benign
R1735:Arhgef19 UTSW 4 140,976,929 (GRCm39) missense possibly damaging 0.55
R1752:Arhgef19 UTSW 4 140,978,354 (GRCm39) missense probably benign 0.27
R1823:Arhgef19 UTSW 4 140,976,457 (GRCm39) missense probably benign 0.01
R1889:Arhgef19 UTSW 4 140,976,624 (GRCm39) missense probably damaging 1.00
R2138:Arhgef19 UTSW 4 140,978,111 (GRCm39) missense probably damaging 1.00
R2280:Arhgef19 UTSW 4 140,973,827 (GRCm39) missense probably benign 0.14
R3430:Arhgef19 UTSW 4 140,984,111 (GRCm39) missense probably benign 0.03
R3954:Arhgef19 UTSW 4 140,983,645 (GRCm39) missense probably damaging 1.00
R4158:Arhgef19 UTSW 4 140,973,660 (GRCm39) missense possibly damaging 0.50
R4160:Arhgef19 UTSW 4 140,973,660 (GRCm39) missense possibly damaging 0.50
R4995:Arhgef19 UTSW 4 140,974,826 (GRCm39) splice site probably null
R5782:Arhgef19 UTSW 4 140,983,623 (GRCm39) missense probably damaging 1.00
R5913:Arhgef19 UTSW 4 140,976,609 (GRCm39) missense probably benign 0.03
R7614:Arhgef19 UTSW 4 140,984,090 (GRCm39) missense possibly damaging 0.52
R8356:Arhgef19 UTSW 4 140,977,926 (GRCm39) missense probably benign 0.25
R8456:Arhgef19 UTSW 4 140,977,926 (GRCm39) missense probably benign 0.25
R8531:Arhgef19 UTSW 4 140,976,903 (GRCm39) missense possibly damaging 0.82
R8876:Arhgef19 UTSW 4 140,975,193 (GRCm39) missense probably benign 0.28
R8931:Arhgef19 UTSW 4 140,976,603 (GRCm39) missense probably damaging 0.98
R8947:Arhgef19 UTSW 4 140,973,618 (GRCm39) missense possibly damaging 0.48
R9019:Arhgef19 UTSW 4 140,973,738 (GRCm39) missense probably benign 0.29
R9036:Arhgef19 UTSW 4 140,976,549 (GRCm39) missense probably damaging 1.00
R9718:Arhgef19 UTSW 4 140,976,603 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTCAGAGGGTTAGAGCTGTG -3'
(R):5'- CTGGACAGCTTCAGTTTGGC -3'

Sequencing Primer
(F):5'- TGGGCATCTGAGAGCCATGTC -3'
(R):5'- CAGCTTCAGTTTGGCTGGCG -3'
Posted On 2016-06-06