Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:Gsap'

391684

Institutional Source

Beutler Lab

Gene Symbol

Gsap

Ensembl Gene

ENSMUSG00000039934

Gene Name

gamma-secretase activating protein

Synonyms

A530088I07Rik, Pion

MMRRC Submission

042622-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R5031 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21186255-21315132 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 21242826 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 294 (S294N)

Ref Sequence

ENSEMBL: ENSMUSP00000043679 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036031] [ENSMUST00000195969] [ENSMUST00000198014] [ENSMUST00000198071] [ENSMUST00000198937]

AlphaFold

Q3TCV3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036031
AA Change: S294N

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000043679
Gene: ENSMUSG00000039934
AA Change: S294N

Domain	Start	End	E-Value	Type
low complexity region	386	398	N/A	INTRINSIC
Pfam:GSAP-16	646	753	6.8e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195969

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197522

Predicted Effect

probably benign
Transcript: ENSMUST00000198014

Predicted Effect

probably benign
Transcript: ENSMUST00000198071

Predicted Effect

probably benign
Transcript: ENSMUST00000198937
AA Change: S294N

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000142986
Gene: ENSMUSG00000039934
AA Change: S294N

Domain	Start	End	E-Value	Type
low complexity region	355	367	N/A	INTRINSIC
Pfam:GSAP-16	608	722	1.6e-42	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accumulation of neurotoxic amyloid-beta is a major hallmark of Alzheimer disease (AD; MIM 104300). Formation of amyloid-beta is catalyzed by gamma-secretase (see PSEN1; MIM 104311), a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, the amyloid-beta precursor protein (APP; MIM 104760) C-terminal fragment (APP-CTF) (He et al., 2010 [PubMed 20811458]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,664,514	N136S	probably damaging	Het
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
Atr	A	G	9: 95,865,702	K346E	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Baz2b	T	C	2: 59,912,807	R1607G	probably benign	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Dock1	A	G	7: 135,152,246	D1584G	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Irs1	A	T	1: 82,286,967	L1176*	probably null	Het
Klhl29	C	T	12: 5,091,334	R550Q	probably benign	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Magel2	T	C	7: 62,380,104	S919P	unknown	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Pik3cb	C	T	9: 99,071,408	D441N	probably damaging	Het
Qrich1	C	T	9: 108,541,736	P464S	possibly damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tram1l1	T	A	3: 124,321,644	L151*	probably null	Het
Trappc12	T	A	12: 28,692,513	I682L	possibly damaging	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Trpm8	A	G	1: 88,348,188	T503A	probably benign	Het
Virma	T	A	4: 11,542,116	Y1567*	probably null	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in Gsap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Gsap	APN	5	21221305	splice site	probably benign
IGL00788:Gsap	APN	5	21254024	missense	probably damaging	0.96
IGL01344:Gsap	APN	5	21242883	critical splice donor site	probably null
IGL01347:Gsap	APN	5	21226320	missense	probably benign	0.08
IGL01618:Gsap	APN	5	21226248	missense	probably damaging	1.00
IGL01730:Gsap	APN	5	21290154	unclassified	probably benign
IGL02061:Gsap	APN	5	21281611	splice site	probably benign
IGL02161:Gsap	APN	5	21253379	missense	probably damaging	1.00
IGL02259:Gsap	APN	5	21186400	missense	probably benign	0.01
IGL02635:Gsap	APN	5	21289816	missense	probably damaging	1.00
IGL02684:Gsap	APN	5	21242803	critical splice acceptor site	probably null
IGL02822:Gsap	APN	5	21217444	missense	probably damaging	1.00
IGL03231:Gsap	APN	5	21229166	missense	probably damaging	0.99
PIT4305001:Gsap	UTSW	5	21186409	missense	probably damaging	0.98
R0012:Gsap	UTSW	5	21226229	splice site	probably benign
R0012:Gsap	UTSW	5	21226229	splice site	probably benign
R0019:Gsap	UTSW	5	21270622	splice site	probably benign
R0019:Gsap	UTSW	5	21270622	splice site	probably benign
R0045:Gsap	UTSW	5	21226832	missense	possibly damaging	0.77
R0054:Gsap	UTSW	5	21250935	splice site	probably benign
R0054:Gsap	UTSW	5	21250935	splice site	probably benign
R0409:Gsap	UTSW	5	21222445	splice site	probably benign
R0507:Gsap	UTSW	5	21269963	missense	possibly damaging	0.75
R0624:Gsap	UTSW	5	21253951	splice site	probably null
R1037:Gsap	UTSW	5	21251165	splice site	probably benign
R1076:Gsap	UTSW	5	21287694	missense	possibly damaging	0.75
R1459:Gsap	UTSW	5	21207238	splice site	probably benign
R1757:Gsap	UTSW	5	21281037	missense	probably damaging	0.98
R1852:Gsap	UTSW	5	21290545	splice site	probably null
R2034:Gsap	UTSW	5	21270595	missense	probably damaging	1.00
R2069:Gsap	UTSW	5	21226839	splice site	probably benign
R2125:Gsap	UTSW	5	21242813	missense	probably damaging	1.00
R2172:Gsap	UTSW	5	21222440	critical splice donor site	probably null
R2310:Gsap	UTSW	5	21196090	nonsense	probably null
R2337:Gsap	UTSW	5	21288630	missense	probably damaging	1.00
R3442:Gsap	UTSW	5	21278127	missense	probably damaging	1.00
R4229:Gsap	UTSW	5	21246977	missense	probably benign	0.00
R4271:Gsap	UTSW	5	21226350	critical splice donor site	probably null
R4551:Gsap	UTSW	5	21290571	missense	probably damaging	1.00
R4553:Gsap	UTSW	5	21290571	missense	probably damaging	1.00
R4649:Gsap	UTSW	5	21226311	missense	probably damaging	1.00
R4687:Gsap	UTSW	5	21246971	utr 3 prime	probably benign
R4799:Gsap	UTSW	5	21250943	missense	probably benign	0.05
R4857:Gsap	UTSW	5	21287799	splice site	probably null
R4973:Gsap	UTSW	5	21254039	missense	probably benign	0.04
R5015:Gsap	UTSW	5	21222408	missense	probably damaging	1.00
R5120:Gsap	UTSW	5	21269936	missense	probably damaging	0.96
R5451:Gsap	UTSW	5	21217447	missense	probably damaging	1.00
R5469:Gsap	UTSW	5	21290544	missense	possibly damaging	0.92
R5519:Gsap	UTSW	5	21289859	missense	probably damaging	1.00
R5588:Gsap	UTSW	5	21251149	missense	probably damaging	1.00
R5650:Gsap	UTSW	5	21251053	missense	probably damaging	0.99
R6064:Gsap	UTSW	5	21229225	missense	possibly damaging	0.56
R6139:Gsap	UTSW	5	21281540	missense	probably damaging	1.00
R6148:Gsap	UTSW	5	21226325	missense	probably damaging	1.00
R6148:Gsap	UTSW	5	21270577	missense	probably benign	0.39
R6226:Gsap	UTSW	5	21217431	missense	probably damaging	1.00
R6859:Gsap	UTSW	5	21281018	missense	probably damaging	0.99
R6977:Gsap	UTSW	5	21271221	missense	probably damaging	1.00
R6995:Gsap	UTSW	5	21271237	missense	possibly damaging	0.58
R7013:Gsap	UTSW	5	21278110	missense	probably benign	0.39
R7159:Gsap	UTSW	5	21270620	splice site	probably null
R7181:Gsap	UTSW	5	21253429	missense	probably damaging	1.00
R7234:Gsap	UTSW	5	21186435	missense	probably benign
R7332:Gsap	UTSW	5	21290121	missense	probably benign	0.00
R7381:Gsap	UTSW	5	21226787	missense	probably damaging	0.96
R8047:Gsap	UTSW	5	21257868	critical splice acceptor site	probably null
R8062:Gsap	UTSW	5	21194463	missense	probably damaging	1.00
R8126:Gsap	UTSW	5	21270012	missense	probably benign	0.04
R8219:Gsap	UTSW	5	21251115	missense	probably benign	0.00
R8355:Gsap	UTSW	5	21251019	nonsense	probably null
R8472:Gsap	UTSW	5	21222434	nonsense	probably null
R8715:Gsap	UTSW	5	21226247	missense	possibly damaging	0.84
R8745:Gsap	UTSW	5	21269951	missense	probably benign	0.05
R8798:Gsap	UTSW	5	21271250	critical splice donor site	probably null
R9080:Gsap	UTSW	5	21194412	missense	possibly damaging	0.52
R9120:Gsap	UTSW	5	21253436	missense	probably damaging	1.00
R9178:Gsap	UTSW	5	21217473	missense	probably damaging	0.98
R9209:Gsap	UTSW	5	21228066	missense	probably benign	0.10
R9404:Gsap	UTSW	5	21269921	missense	probably damaging	1.00
Z1177:Gsap	UTSW	5	21251032	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCTGACCTGAAATTTCATAGCAGC -3'
(R):5'- GAACAAATGACAGCCTGGC -3'

Sequencing Primer
(F):5'- CATAGCAGCTTGATAATATCCCTTTG -3'
(R):5'- TGACAGCCTGGCATAAAAACATATAG -3'

Posted On

2016-06-06