Incidental Mutation 'R5031:Gsap'
ID391684
Institutional Source Beutler Lab
Gene Symbol Gsap
Ensembl Gene ENSMUSG00000039934
Gene Namegamma-secretase activating protein
SynonymsA530088I07Rik, Pion
MMRRC Submission 042622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5031 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location21186255-21315132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21242826 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 294 (S294N)
Ref Sequence ENSEMBL: ENSMUSP00000043679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036031] [ENSMUST00000195969] [ENSMUST00000198014] [ENSMUST00000198071] [ENSMUST00000198937]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036031
AA Change: S294N

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043679
Gene: ENSMUSG00000039934
AA Change: S294N

DomainStartEndE-ValueType
low complexity region 386 398 N/A INTRINSIC
Pfam:GSAP-16 646 753 6.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197522
Predicted Effect probably benign
Transcript: ENSMUST00000198014
Predicted Effect probably benign
Transcript: ENSMUST00000198071
Predicted Effect probably benign
Transcript: ENSMUST00000198937
AA Change: S294N

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000142986
Gene: ENSMUSG00000039934
AA Change: S294N

DomainStartEndE-ValueType
low complexity region 355 367 N/A INTRINSIC
Pfam:GSAP-16 608 722 1.6e-42 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accumulation of neurotoxic amyloid-beta is a major hallmark of Alzheimer disease (AD; MIM 104300). Formation of amyloid-beta is catalyzed by gamma-secretase (see PSEN1; MIM 104311), a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, the amyloid-beta precursor protein (APP; MIM 104760) C-terminal fragment (APP-CTF) (He et al., 2010 [PubMed 20811458]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,664,514 N136S probably damaging Het
Abca13 A T 11: 9,297,678 N2475I probably damaging Het
Acnat2 T C 4: 49,380,631 K231R probably damaging Het
Ank1 C T 8: 23,099,680 P599L probably damaging Het
Arhgef19 A G 4: 141,250,810 E580G probably damaging Het
Atr A G 9: 95,865,702 K346E probably damaging Het
AU021092 T C 16: 5,212,604 K309E probably damaging Het
Baz2b T C 2: 59,912,807 R1607G probably benign Het
Cct8 C T 16: 87,487,538 V254M probably damaging Het
Cdca2 T A 14: 67,713,153 I110F probably damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Dmkn A G 7: 30,764,236 I105V probably benign Het
Dock1 A G 7: 135,152,246 D1584G probably benign Het
Epg5 G A 18: 78,028,948 V2392I probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hectd2 A G 19: 36,599,604 N142D probably damaging Het
Hmcn1 A G 1: 150,588,257 C5091R probably damaging Het
Ifitm5 G A 7: 140,950,104 R36* probably null Het
Ints2 G A 11: 86,256,200 P40L probably damaging Het
Irs1 A T 1: 82,286,967 L1176* probably null Het
Klhl29 C T 12: 5,091,334 R550Q probably benign Het
Kyat1 A G 2: 30,188,090 M134T probably damaging Het
Lrrk2 A T 15: 91,700,619 N384Y possibly damaging Het
Magel2 T C 7: 62,380,104 S919P unknown Het
Mettl16 A T 11: 74,802,999 I279F probably benign Het
Mrgpra1 A T 7: 47,335,237 Y231* probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mut T C 17: 40,938,827 F231S possibly damaging Het
Mvp A C 7: 126,993,616 Y374* probably null Het
Nabp2 G A 10: 128,409,628 probably benign Het
Nos1 C T 5: 117,879,313 P247L probably benign Het
Olfr1015 T A 2: 85,785,718 L69* probably null Het
Olfr1115 C A 2: 87,252,082 F48L probably benign Het
Pik3cb C T 9: 99,071,408 D441N probably damaging Het
Qrich1 C T 9: 108,541,736 P464S possibly damaging Het
Rab17 A T 1: 90,960,138 probably null Het
Rspo3 A T 10: 29,506,447 L77H probably damaging Het
Spn G T 7: 127,137,230 T35K probably benign Het
Sult1d1 T A 5: 87,559,844 Y139F possibly damaging Het
Tbc1d32 C A 10: 56,123,531 Q848H probably damaging Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tram1l1 T A 3: 124,321,644 L151* probably null Het
Trappc12 T A 12: 28,692,513 I682L possibly damaging Het
Trav6d-4 A C 14: 52,753,599 T31P probably damaging Het
Trpm8 A G 1: 88,348,188 T503A probably benign Het
Virma T A 4: 11,542,116 Y1567* probably null Het
Vmn1r228 T A 17: 20,776,681 K192* probably null Het
Zfp521 T A 18: 13,844,273 T1028S possibly damaging Het
Zfp583 T A 7: 6,317,398 Q205L probably benign Het
Other mutations in Gsap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Gsap APN 5 21221305 splice site probably benign
IGL00788:Gsap APN 5 21254024 missense probably damaging 0.96
IGL01344:Gsap APN 5 21242883 critical splice donor site probably null
IGL01347:Gsap APN 5 21226320 missense probably benign 0.08
IGL01618:Gsap APN 5 21226248 missense probably damaging 1.00
IGL01730:Gsap APN 5 21290154 unclassified probably benign
IGL02061:Gsap APN 5 21281611 splice site probably benign
IGL02161:Gsap APN 5 21253379 missense probably damaging 1.00
IGL02259:Gsap APN 5 21186400 missense probably benign 0.01
IGL02635:Gsap APN 5 21289816 missense probably damaging 1.00
IGL02684:Gsap APN 5 21242803 critical splice acceptor site probably null
IGL02822:Gsap APN 5 21217444 missense probably damaging 1.00
IGL03231:Gsap APN 5 21229166 missense probably damaging 0.99
PIT4305001:Gsap UTSW 5 21186409 missense probably damaging 0.98
R0012:Gsap UTSW 5 21226229 splice site probably benign
R0012:Gsap UTSW 5 21226229 splice site probably benign
R0019:Gsap UTSW 5 21270622 splice site probably benign
R0019:Gsap UTSW 5 21270622 splice site probably benign
R0045:Gsap UTSW 5 21226832 missense possibly damaging 0.77
R0054:Gsap UTSW 5 21250935 splice site probably benign
R0054:Gsap UTSW 5 21250935 splice site probably benign
R0409:Gsap UTSW 5 21222445 splice site probably benign
R0507:Gsap UTSW 5 21269963 missense possibly damaging 0.75
R0624:Gsap UTSW 5 21253951 splice site probably null
R1037:Gsap UTSW 5 21251165 splice site probably benign
R1076:Gsap UTSW 5 21287694 missense possibly damaging 0.75
R1459:Gsap UTSW 5 21207238 splice site probably benign
R1757:Gsap UTSW 5 21281037 missense probably damaging 0.98
R1852:Gsap UTSW 5 21290545 splice site probably null
R2034:Gsap UTSW 5 21270595 missense probably damaging 1.00
R2069:Gsap UTSW 5 21226839 splice site probably benign
R2125:Gsap UTSW 5 21242813 missense probably damaging 1.00
R2172:Gsap UTSW 5 21222440 critical splice donor site probably null
R2310:Gsap UTSW 5 21196090 nonsense probably null
R2337:Gsap UTSW 5 21288630 missense probably damaging 1.00
R3442:Gsap UTSW 5 21278127 missense probably damaging 1.00
R4229:Gsap UTSW 5 21246977 missense probably benign 0.00
R4271:Gsap UTSW 5 21226350 critical splice donor site probably null
R4551:Gsap UTSW 5 21290571 missense probably damaging 1.00
R4553:Gsap UTSW 5 21290571 missense probably damaging 1.00
R4649:Gsap UTSW 5 21226311 missense probably damaging 1.00
R4687:Gsap UTSW 5 21246971 utr 3 prime probably benign
R4799:Gsap UTSW 5 21250943 missense probably benign 0.05
R4857:Gsap UTSW 5 21287799 splice site probably null
R4973:Gsap UTSW 5 21254039 missense probably benign 0.04
R5015:Gsap UTSW 5 21222408 missense probably damaging 1.00
R5120:Gsap UTSW 5 21269936 missense probably damaging 0.96
R5451:Gsap UTSW 5 21217447 missense probably damaging 1.00
R5469:Gsap UTSW 5 21290544 missense possibly damaging 0.92
R5519:Gsap UTSW 5 21289859 missense probably damaging 1.00
R5588:Gsap UTSW 5 21251149 missense probably damaging 1.00
R5650:Gsap UTSW 5 21251053 missense probably damaging 0.99
R6064:Gsap UTSW 5 21229225 missense possibly damaging 0.56
R6139:Gsap UTSW 5 21281540 missense probably damaging 1.00
R6148:Gsap UTSW 5 21226325 missense probably damaging 1.00
R6148:Gsap UTSW 5 21270577 missense probably benign 0.39
R6226:Gsap UTSW 5 21217431 missense probably damaging 1.00
R6859:Gsap UTSW 5 21281018 missense probably damaging 0.99
R6977:Gsap UTSW 5 21271221 missense probably damaging 1.00
R6995:Gsap UTSW 5 21271237 missense possibly damaging 0.58
R7013:Gsap UTSW 5 21278110 missense probably benign 0.39
R7159:Gsap UTSW 5 21270620 splice site probably null
R7181:Gsap UTSW 5 21253429 missense probably damaging 1.00
R7234:Gsap UTSW 5 21186435 missense probably benign
R7332:Gsap UTSW 5 21290121 missense probably benign 0.00
R7381:Gsap UTSW 5 21226787 missense probably damaging 0.96
R8047:Gsap UTSW 5 21257868 critical splice acceptor site probably null
R8062:Gsap UTSW 5 21194463 missense probably damaging 1.00
R8126:Gsap UTSW 5 21270012 missense probably benign 0.04
R8219:Gsap UTSW 5 21251115 missense probably benign 0.00
Z1177:Gsap UTSW 5 21251032 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTGACCTGAAATTTCATAGCAGC -3'
(R):5'- GAACAAATGACAGCCTGGC -3'

Sequencing Primer
(F):5'- CATAGCAGCTTGATAATATCCCTTTG -3'
(R):5'- TGACAGCCTGGCATAAAAACATATAG -3'
Posted On2016-06-06