Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:Magel2'

391691

Institutional Source

Beutler Lab

Gene Symbol

Magel2

Ensembl Gene

ENSMUSG00000056972

Gene Name

melanoma antigen, family L, 2

Synonyms

nM15, ns7, NDNL1, Mage-l2

MMRRC Submission

042622-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5031 (G1)

Quality Score

155

Status

Validated

Chromosome

Chromosomal Location

62377010-62381640 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62380104 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 919 (S919P)

Ref Sequence

ENSEMBL: ENSMUSP00000079265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080403]

AlphaFold

Q9QZ04

Predicted Effect

unknown
Transcript: ENSMUST00000080403
AA Change: S919P

SMART Domains

Protein: ENSMUSP00000079265
Gene: ENSMUSG00000056972
AA Change: S919P

Domain	Start	End	E-Value	Type
low complexity region	30	49	N/A	INTRINSIC
low complexity region	51	84	N/A	INTRINSIC
internal_repeat_1	85	131	2.45e-10	PROSPERO
low complexity region	134	205	N/A	INTRINSIC
internal_repeat_1	222	298	2.45e-10	PROSPERO
internal_repeat_2	289	332	6.32e-5	PROSPERO
low complexity region	347	363	N/A	INTRINSIC
low complexity region	467	492	N/A	INTRINSIC
internal_repeat_2	494	535	6.32e-5	PROSPERO
low complexity region	560	648	N/A	INTRINSIC
low complexity region	675	686	N/A	INTRINSIC
low complexity region	761	785	N/A	INTRINSIC
low complexity region	903	920	N/A	INTRINSIC
MAGE	1059	1229	6.82e-65	SMART
low complexity region	1262	1284	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207232

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13 region. Affected individuals exhibit neonatal hypotonia, developmental delay, and childhood-onset obesity. Necdin (NDN), a gene involved in the terminal differentiation of neurons, localizes to this region of the genome and has been implicated as one of the genes responsible for the etiology of PWS. This gene is structurally similar to NDN, is also localized to the PWS chromosomal region, and is paternally imprinted, suggesting a possible role for it in PWS. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice heterozygous for a null allele that is inherited paternally exhibit some postnatal lethality, reduced male fertility, abnormal circadian rhythm, and hypoactivity. Mice heterozygous for another paternal knock-out allele exhibit 50% neonatal lethalityassociated with weak suckling activity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,664,514	N136S	probably damaging	Het
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
Atr	A	G	9: 95,865,702	K346E	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Baz2b	T	C	2: 59,912,807	R1607G	probably benign	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Dock1	A	G	7: 135,152,246	D1584G	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gsap	G	A	5: 21,242,826	S294N	possibly damaging	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Irs1	A	T	1: 82,286,967	L1176*	probably null	Het
Klhl29	C	T	12: 5,091,334	R550Q	probably benign	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Pik3cb	C	T	9: 99,071,408	D441N	probably damaging	Het
Qrich1	C	T	9: 108,541,736	P464S	possibly damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tram1l1	T	A	3: 124,321,644	L151*	probably null	Het
Trappc12	T	A	12: 28,692,513	I682L	possibly damaging	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Trpm8	A	G	1: 88,348,188	T503A	probably benign	Het
Virma	T	A	4: 11,542,116	Y1567*	probably null	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in Magel2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00948:Magel2	APN	7	62379322	missense	unknown
IGL01391:Magel2	APN	7	62380884	missense	unknown
IGL01876:Magel2	APN	7	62378827	missense	possibly damaging	0.68
IGL02613:Magel2	APN	7	62380198	missense	unknown
IGL02617:Magel2	APN	7	62380198	missense	unknown
IGL03256:Magel2	APN	7	62380414	missense	unknown
IGL03382:Magel2	APN	7	62378713	missense	probably benign	0.00
astroclast2	UTSW	7	62380159	missense	unknown
IGL02837:Magel2	UTSW	7	62378260	missense	possibly damaging	0.93
R0398:Magel2	UTSW	7	62380551	nonsense	probably null
R0463:Magel2	UTSW	7	62378030	missense	possibly damaging	0.53
R1033:Magel2	UTSW	7	62380050	missense	unknown
R1271:Magel2	UTSW	7	62381014	missense	unknown
R1518:Magel2	UTSW	7	62380440	missense	unknown
R1539:Magel2	UTSW	7	62378809	missense	possibly damaging	0.91
R1682:Magel2	UTSW	7	62380235	missense	unknown
R1686:Magel2	UTSW	7	62378240	missense	possibly damaging	0.53
R1782:Magel2	UTSW	7	62380857	nonsense	probably null
R1785:Magel2	UTSW	7	62377738	missense	unknown
R1786:Magel2	UTSW	7	62377738	missense	unknown
R1950:Magel2	UTSW	7	62378415	missense	possibly damaging	0.48
R2001:Magel2	UTSW	7	62379096	missense	unknown
R2002:Magel2	UTSW	7	62379096	missense	unknown
R2018:Magel2	UTSW	7	62379096	missense	unknown
R2019:Magel2	UTSW	7	62379096	missense	unknown
R2029:Magel2	UTSW	7	62380594	missense	unknown
R2070:Magel2	UTSW	7	62379096	missense	unknown
R2131:Magel2	UTSW	7	62377738	missense	unknown
R2132:Magel2	UTSW	7	62377738	missense	unknown
R2133:Magel2	UTSW	7	62377738	missense	unknown
R2134:Magel2	UTSW	7	62379096	missense	unknown
R2155:Magel2	UTSW	7	62380792	missense	unknown
R4294:Magel2	UTSW	7	62378767	missense	possibly damaging	0.86
R4591:Magel2	UTSW	7	62381089	missense	unknown
R4621:Magel2	UTSW	7	62377738	missense	unknown
R4816:Magel2	UTSW	7	62381092	missense	unknown
R4931:Magel2	UTSW	7	62380624	missense	unknown
R5034:Magel2	UTSW	7	62379868	missense	unknown
R5042:Magel2	UTSW	7	62379606	missense	unknown
R5600:Magel2	UTSW	7	62379766	missense	unknown
R5769:Magel2	UTSW	7	62378113	missense	probably benign	0.02
R5980:Magel2	UTSW	7	62380596	missense	unknown
R5987:Magel2	UTSW	7	62378767	missense	probably benign	0.33
R6187:Magel2	UTSW	7	62377641	missense	unknown
R6267:Magel2	UTSW	7	62378679	missense	probably damaging	0.98
R6270:Magel2	UTSW	7	62380658	nonsense	probably null
R6316:Magel2	UTSW	7	62378719	missense	possibly damaging	0.68
R6444:Magel2	UTSW	7	62379999	missense	unknown
R6452:Magel2	UTSW	7	62380384	missense	unknown
R6797:Magel2	UTSW	7	62380159	missense	unknown
R6917:Magel2	UTSW	7	62377844	small deletion	probably benign
R7011:Magel2	UTSW	7	62378533	missense	possibly damaging	0.92
R7025:Magel2	UTSW	7	62379787	missense	unknown
R7335:Magel2	UTSW	7	62380776	missense	unknown
R7353:Magel2	UTSW	7	62379331	missense	unknown
R7413:Magel2	UTSW	7	62377844	small deletion	probably benign
R7570:Magel2	UTSW	7	62378910	missense	possibly damaging	0.53
R7714:Magel2	UTSW	7	62378382	missense	probably benign	0.08
R7836:Magel2	UTSW	7	62378368	missense	possibly damaging	0.73
R8289:Magel2	UTSW	7	62379127	missense	unknown
R8717:Magel2	UTSW	7	62377672	missense	unknown
R8903:Magel2	UTSW	7	62379693	missense	unknown
R8911:Magel2	UTSW	7	62379789	missense	unknown
R8971:Magel2	UTSW	7	62380251	missense	unknown
R9096:Magel2	UTSW	7	62380549	missense	unknown
R9264:Magel2	UTSW	7	62378596	missense	possibly damaging	0.95
RF022:Magel2	UTSW	7	62380093	missense	unknown
Z1088:Magel2	UTSW	7	62378977	missense	possibly damaging	0.53
Z1177:Magel2	UTSW	7	62379607	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCATTTGCTCTGCAGGATCC -3'
(R):5'- CCTTGGCATCCTAGAAGTGTTGG -3'

Sequencing Primer
(F):5'- CAGGATCCTTATGCCTGCGTAGAG -3'
(R):5'- CATCCTAGAAGTGTTGGGGCAC -3'

Posted On

2016-06-06