Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:Dock1'

391694

Institutional Source

Beutler Lab

Gene Symbol

Dock1

Ensembl Gene

ENSMUSG00000058325

Gene Name

dedicator of cytokinesis 1

Synonyms

D630004B07Rik, Dock180, 9130006G06Rik

MMRRC Submission

042622-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

134670654-135173639 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135152246 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1584 (D1584G)

Ref Sequence

ENSEMBL: ENSMUSP00000081531 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084488]

AlphaFold

Q8BUR4

PDB Structure

Solution structure of the SH3 domain of DOCK180 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000084488
AA Change: D1584G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325
AA Change: D1584G

Domain	Start	End	E-Value	Type
SH3	12	69	7.57e-17	SMART
Pfam:DOCK_N	72	416	1.7e-113	PFAM
Pfam:DOCK-C2	421	618	1.2e-61	PFAM
low complexity region	628	639	N/A	INTRINSIC
Pfam:DHR-2	1111	1610	3.3e-102	PFAM
low complexity region	1639	1664	N/A	INTRINSIC
low complexity region	1683	1701	N/A	INTRINSIC
low complexity region	1756	1773	N/A	INTRINSIC
low complexity region	1823	1857	N/A	INTRINSIC

Meta Mutation Damage Score

0.1070

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Dedicator of cytokinesis proteins act as guanine nucleotide exchange factors for small Rho family G proteins. The encoded protein regulates the small GTPase Rac, thereby influencing several biological processes, including phagocytosis and cell migration. Overexpression of this gene has also been associated with certain cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality associated with abnormal muscle development and failure of lungs to inflate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,664,514	N136S	probably damaging	Het
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
Atr	A	G	9: 95,865,702	K346E	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Baz2b	T	C	2: 59,912,807	R1607G	probably benign	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gsap	G	A	5: 21,242,826	S294N	possibly damaging	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Irs1	A	T	1: 82,286,967	L1176*	probably null	Het
Klhl29	C	T	12: 5,091,334	R550Q	probably benign	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Magel2	T	C	7: 62,380,104	S919P	unknown	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Pik3cb	C	T	9: 99,071,408	D441N	probably damaging	Het
Qrich1	C	T	9: 108,541,736	P464S	possibly damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tram1l1	T	A	3: 124,321,644	L151*	probably null	Het
Trappc12	T	A	12: 28,692,513	I682L	possibly damaging	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Trpm8	A	G	1: 88,348,188	T503A	probably benign	Het
Virma	T	A	4: 11,542,116	Y1567*	probably null	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in Dock1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Dock1	APN	7	135146531	splice site	probably benign
IGL01319:Dock1	APN	7	134789278	missense	probably benign
IGL01390:Dock1	APN	7	134745047	missense	possibly damaging	0.95
IGL01394:Dock1	APN	7	134766216	missense	probably benign	0.01
IGL01489:Dock1	APN	7	134999321	splice site	probably benign
IGL01505:Dock1	APN	7	135158510	missense	possibly damaging	0.91
IGL01586:Dock1	APN	7	134753377	missense	probably damaging	1.00
IGL01637:Dock1	APN	7	135137813	critical splice acceptor site	probably null
IGL01649:Dock1	APN	7	134777410	missense	probably damaging	1.00
IGL01652:Dock1	APN	7	134777497	splice site	probably benign
IGL01859:Dock1	APN	7	135077161	missense	possibly damaging	0.51
IGL02068:Dock1	APN	7	134771548	missense	probably benign	0.26
IGL02168:Dock1	APN	7	135077131	splice site	probably benign
IGL02200:Dock1	APN	7	134744271	missense	probably benign	0.01
IGL02244:Dock1	APN	7	134777445	nonsense	probably null
IGL02285:Dock1	APN	7	135081920	critical splice donor site	probably null
IGL02319:Dock1	APN	7	134772449	missense	possibly damaging	0.94
IGL02334:Dock1	APN	7	135145565	missense	probably damaging	1.00
IGL02338:Dock1	APN	7	135133075	missense	possibly damaging	0.95
IGL02351:Dock1	APN	7	135108819	missense	possibly damaging	0.51
IGL02358:Dock1	APN	7	135108819	missense	possibly damaging	0.51
IGL02607:Dock1	APN	7	134851513	missense	probably benign	0.13
IGL02638:Dock1	APN	7	135146480	missense	probably benign	0.09
IGL02724:Dock1	APN	7	135163353	missense	probably benign
IGL02820:Dock1	APN	7	135167215	missense	probably benign	0.11
IGL02950:Dock1	APN	7	134730024	missense	probably damaging	1.00
IGL02993:Dock1	APN	7	134744298	missense	probably benign
IGL03000:Dock1	APN	7	134789240	missense	probably benign	0.17
IGL03092:Dock1	APN	7	134765216	splice site	probably benign
IGL03131:Dock1	APN	7	134874183	missense	possibly damaging	0.80
IGL03136:Dock1	APN	7	135168389	missense	probably benign	0.00
IGL03210:Dock1	APN	7	134756939	missense	possibly damaging	0.62
IGL03220:Dock1	APN	7	135108522	critical splice donor site	probably null
P0028:Dock1	UTSW	7	134999324	splice site	probably benign
PIT4453001:Dock1	UTSW	7	135152300	missense	probably benign
R0003:Dock1	UTSW	7	134730064	splice site	probably benign
R0058:Dock1	UTSW	7	135108761	missense	possibly damaging	0.65
R0058:Dock1	UTSW	7	135108761	missense	possibly damaging	0.65
R0062:Dock1	UTSW	7	134777495	splice site	probably null
R0062:Dock1	UTSW	7	134777495	splice site	probably null
R0179:Dock1	UTSW	7	135098837	missense	probably damaging	0.99
R0180:Dock1	UTSW	7	135098837	missense	probably damaging	0.99
R0347:Dock1	UTSW	7	134763867	missense	probably damaging	1.00
R0399:Dock1	UTSW	7	135163442	missense	probably benign	0.00
R0457:Dock1	UTSW	7	135138145	missense	possibly damaging	0.90
R0480:Dock1	UTSW	7	134737718	missense	probably damaging	1.00
R0521:Dock1	UTSW	7	135143778	missense	probably benign	0.21
R0792:Dock1	UTSW	7	134874150	missense	probably benign	0.02
R1136:Dock1	UTSW	7	134848173	missense	possibly damaging	0.95
R1224:Dock1	UTSW	7	135108819	missense	possibly damaging	0.67
R1267:Dock1	UTSW	7	134746436	missense	probably damaging	1.00
R1373:Dock1	UTSW	7	135167175	missense	probably benign	0.01
R1401:Dock1	UTSW	7	135133936	nonsense	probably null
R1454:Dock1	UTSW	7	134851609	splice site	probably benign
R1465:Dock1	UTSW	7	134782409	missense	probably benign	0.00
R1465:Dock1	UTSW	7	134782409	missense	probably benign	0.00
R1523:Dock1	UTSW	7	134744247	missense	possibly damaging	0.49
R1643:Dock1	UTSW	7	135098779	missense	probably damaging	1.00
R1659:Dock1	UTSW	7	134789243	missense	probably damaging	0.98
R1793:Dock1	UTSW	7	135098727	splice site	probably null
R1864:Dock1	UTSW	7	135146507	missense	probably benign	0.07
R1911:Dock1	UTSW	7	134999300	missense	probably damaging	1.00
R2567:Dock1	UTSW	7	135145484	missense	probably damaging	1.00
R3816:Dock1	UTSW	7	134744286	nonsense	probably null
R3971:Dock1	UTSW	7	134746908	missense	probably damaging	1.00
R4063:Dock1	UTSW	7	135115292	missense	possibly damaging	0.81
R4163:Dock1	UTSW	7	134744322	missense	possibly damaging	0.79
R4271:Dock1	UTSW	7	134734054	missense	probably damaging	0.99
R4684:Dock1	UTSW	7	134724409	nonsense	probably null
R4717:Dock1	UTSW	7	134848170	missense	probably damaging	1.00
R4725:Dock1	UTSW	7	134745014	nonsense	probably null
R4788:Dock1	UTSW	7	135145484	missense	probably damaging	0.98
R4869:Dock1	UTSW	7	134734071	missense	probably damaging	1.00
R4889:Dock1	UTSW	7	134744976	missense	probably benign	0.02
R4953:Dock1	UTSW	7	135152288	missense	probably benign	0.34
R5161:Dock1	UTSW	7	134734062	missense	possibly damaging	0.69
R5168:Dock1	UTSW	7	135118908	missense	probably damaging	1.00
R5212:Dock1	UTSW	7	134789194	missense	possibly damaging	0.68
R5648:Dock1	UTSW	7	134746954	missense	probably damaging	1.00
R5685:Dock1	UTSW	7	134772362	missense	probably benign	0.19
R5834:Dock1	UTSW	7	134763933	missense	probably damaging	1.00
R6181:Dock1	UTSW	7	135158522	missense	probably damaging	1.00
R6334:Dock1	UTSW	7	134851576	missense	probably benign	0.01
R6406:Dock1	UTSW	7	135145486	missense	probably benign	0.26
R6425:Dock1	UTSW	7	135163381	missense	possibly damaging	0.79
R6489:Dock1	UTSW	7	134990541	missense	probably damaging	0.99
R6616:Dock1	UTSW	7	135108492	missense	possibly damaging	0.85
R6706:Dock1	UTSW	7	135133886	missense	possibly damaging	0.72
R6766:Dock1	UTSW	7	134756793	splice site	probably null
R6861:Dock1	UTSW	7	134771478	missense	probably benign	0.00
R6985:Dock1	UTSW	7	135163403	missense	possibly damaging	0.95
R7259:Dock1	UTSW	7	134782748	missense	probably damaging	0.99
R7285:Dock1	UTSW	7	134745008	missense	probably benign	0.01
R7471:Dock1	UTSW	7	135163343	missense	possibly damaging	0.65
R7497:Dock1	UTSW	7	134765274	missense	probably benign
R7691:Dock1	UTSW	7	135138157	critical splice donor site	probably null
R7732:Dock1	UTSW	7	134744970	missense	probably benign	0.01
R7818:Dock1	UTSW	7	134763865	missense	probably damaging	1.00
R7918:Dock1	UTSW	7	135145418	missense	probably damaging	1.00
R7960:Dock1	UTSW	7	135077188	missense	possibly damaging	0.83
R7961:Dock1	UTSW	7	134745057	missense	possibly damaging	0.77
R7985:Dock1	UTSW	7	134746954	missense	possibly damaging	0.95
R8009:Dock1	UTSW	7	134745057	missense	possibly damaging	0.77
R8060:Dock1	UTSW	7	135168403	missense	probably benign
R8060:Dock1	UTSW	7	134990629	splice site	probably benign
R8061:Dock1	UTSW	7	134772323	missense	probably benign	0.00
R8101:Dock1	UTSW	7	134999288	missense	possibly damaging	0.89
R8405:Dock1	UTSW	7	134777463	missense	probably benign	0.04
R8508:Dock1	UTSW	7	134782409	missense	probably benign	0.00
R8803:Dock1	UTSW	7	134874087	missense	probably benign	0.28
R9007:Dock1	UTSW	7	134899096	intron	probably benign
R9026:Dock1	UTSW	7	135119017	missense	probably damaging	0.97
R9111:Dock1	UTSW	7	134999288	missense	possibly damaging	0.89
R9359:Dock1	UTSW	7	135168396	missense	probably benign
R9398:Dock1	UTSW	7	135172499	missense	probably damaging	0.99
R9403:Dock1	UTSW	7	135168396	missense	probably benign
R9408:Dock1	UTSW	7	135115336	missense	probably damaging	0.99
R9476:Dock1	UTSW	7	134990550	missense	probably benign	0.10
R9478:Dock1	UTSW	7	134766233	missense	probably damaging	1.00
R9510:Dock1	UTSW	7	134990550	missense	probably benign	0.10
R9544:Dock1	UTSW	7	134746457	missense	possibly damaging	0.71
R9605:Dock1	UTSW	7	134782412	missense	possibly damaging	0.49
R9657:Dock1	UTSW	7	134737700	missense	possibly damaging	0.58
R9767:Dock1	UTSW	7	134741067	missense	possibly damaging	0.68
X0062:Dock1	UTSW	7	135108451	missense	probably damaging	1.00
Z1088:Dock1	UTSW	7	134804547	missense	probably damaging	0.98
Z1177:Dock1	UTSW	7	134782400	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCCTGTCTGCTGATGAGTTTAATC -3'
(R):5'- GCACACTACTCAGAGACGATG -3'

Sequencing Primer
(F):5'- CAGTCACTCTGATTTGGGAACAG -3'
(R):5'- ACTCCCATAAAGTGAGCTTGG -3'

Posted On

2016-06-06