Incidental Mutation 'R5031:Ank1'
ID 391696
Institutional Source Beutler Lab
Gene Symbol Ank1
Ensembl Gene ENSMUSG00000031543
Gene Name ankyrin 1, erythroid
Synonyms Ank-1, pale
MMRRC Submission 042622-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.447) question?
Stock # R5031 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 23464860-23640513 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 23589696 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 599 (P599L)
Ref Sequence ENSEMBL: ENSMUSP00000133322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084038] [ENSMUST00000110688] [ENSMUST00000117270] [ENSMUST00000117296] [ENSMUST00000117662] [ENSMUST00000118733] [ENSMUST00000152511] [ENSMUST00000121802] [ENSMUST00000141784] [ENSMUST00000173248] [ENSMUST00000173573] [ENSMUST00000123418]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000084038
AA Change: P599L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081051
Gene: ENSMUSG00000031543
AA Change: P599L

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110688
AA Change: P628L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106316
Gene: ENSMUSG00000031543
AA Change: P628L

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 944 1048 1.9e-60 SMART
low complexity region 1071 1080 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
DEATH 1426 1520 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117270
AA Change: P628L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113495
Gene: ENSMUSG00000031543
AA Change: P628L

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 952 1056 1.9e-60 SMART
low complexity region 1079 1088 N/A INTRINSIC
low complexity region 1416 1426 N/A INTRINSIC
DEATH 1434 1528 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117296
AA Change: P591L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113656
Gene: ENSMUSG00000031543
AA Change: P591L

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117662
AA Change: P591L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113531
Gene: ENSMUSG00000031543
AA Change: P591L

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118733
AA Change: P599L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112850
Gene: ENSMUSG00000031543
AA Change: P599L

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152511
AA Change: P192L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116533
Gene: ENSMUSG00000031543
AA Change: P192L

DomainStartEndE-ValueType
ANK 1 29 4.82e-3 SMART
ANK 33 62 7.53e-5 SMART
ANK 66 95 5.49e-7 SMART
ANK 99 128 2.58e-3 SMART
ANK 132 161 1.88e-5 SMART
ANK 165 194 1.02e-6 SMART
ANK 198 227 7.64e-6 SMART
ANK 231 262 3.23e-4 SMART
ANK 264 293 1.38e-3 SMART
ANK 297 326 1.58e-7 SMART
ANK 330 359 2.85e-5 SMART
ZU5 508 612 1.9e-60 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
DEATH 990 1090 4.31e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121802
AA Change: P628L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113571
Gene: ENSMUSG00000031543
AA Change: P628L

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 952 1056 1.9e-60 SMART
low complexity region 1079 1088 N/A INTRINSIC
low complexity region 1416 1426 N/A INTRINSIC
DEATH 1434 1528 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000141784
AA Change: P591L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117966
Gene: ENSMUSG00000031543
AA Change: P591L

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173248
AA Change: P599L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133322
Gene: ENSMUSG00000031543
AA Change: P599L

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173573
AA Change: P599L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133901
Gene: ENSMUSG00000031543
AA Change: P599L

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197671
Predicted Effect probably benign
Transcript: ENSMUST00000123418
SMART Domains Protein: ENSMUSP00000121785
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
Meta Mutation Damage Score 0.4338 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ankyrins are a family of proteins that link the integral membrane proteins to the underlying spectrin-actin cytoskeleton and play key roles in activities such as cell motility, activation, proliferation, contact and the maintenance of specialized membrane domains. Multiple isoforms of ankyrin with different affinities for various target proteins are expressed in a tissue-specific, developmentally regulated manner. Most ankyrins are typically composed of three structural domains: an amino-terminal domain containing multiple ankyrin repeats; a central region with a highly conserved spectrin binding domain; and a carboxy-terminal regulatory domain which is the least conserved and subject to variation. Ankyrin 1, the prototype of this family, was first discovered in the erythrocytes, but since has also been found in brain and muscles. Mutations in erythrocytic ankyrin 1 have been associated in approximately half of all patients with hereditary spherocytosis. Complex patterns of alternative splicing in the regulatory domain, giving rise to different isoforms of ankyrin 1 have been described. Truncated muscle-specific isoforms of ankyrin 1 resulting from usage of an alternate promoter have also been identified. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutant animals are anemic, infertile, and have reduced body size. Mutant animals also exhibit jaundice, bone marrow hyperplasia, splenomegaly, hepatomegaly, enlarged lymph nodes, increased white blood cell count, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,247,678 (GRCm39) N2475I probably damaging Het
Acnat2 T C 4: 49,380,631 (GRCm39) K231R probably damaging Het
Arhgef19 A G 4: 140,978,121 (GRCm39) E580G probably damaging Het
Atr A G 9: 95,747,755 (GRCm39) K346E probably damaging Het
AU021092 T C 16: 5,030,468 (GRCm39) K309E probably damaging Het
Baz2b T C 2: 59,743,151 (GRCm39) R1607G probably benign Het
Cct8 C T 16: 87,284,426 (GRCm39) V254M probably damaging Het
Cdca2 T A 14: 67,950,602 (GRCm39) I110F probably damaging Het
Csmd3 A T 15: 47,522,588 (GRCm39) C2694S probably damaging Het
Dmkn A G 7: 30,463,661 (GRCm39) I105V probably benign Het
Dock1 A G 7: 134,753,975 (GRCm39) D1584G probably benign Het
Epg5 G A 18: 78,072,163 (GRCm39) V2392I probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Gsap G A 5: 21,447,824 (GRCm39) S294N possibly damaging Het
Hectd2 A G 19: 36,577,004 (GRCm39) N142D probably damaging Het
Hmcn1 A G 1: 150,464,008 (GRCm39) C5091R probably damaging Het
Ifitm5 G A 7: 140,530,017 (GRCm39) R36* probably null Het
Ints2 G A 11: 86,147,026 (GRCm39) P40L probably damaging Het
Irs1 A T 1: 82,264,688 (GRCm39) L1176* probably null Het
Klhl29 C T 12: 5,141,334 (GRCm39) R550Q probably benign Het
Kyat1 A G 2: 30,078,102 (GRCm39) M134T probably damaging Het
Lrrk2 A T 15: 91,584,822 (GRCm39) N384Y possibly damaging Het
Magel2 T C 7: 62,029,852 (GRCm39) S919P unknown Het
Mettl16 A T 11: 74,693,825 (GRCm39) I279F probably benign Het
Mmut T C 17: 41,249,718 (GRCm39) F231S possibly damaging Het
Mrgpra1 A T 7: 46,984,985 (GRCm39) Y231* probably null Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Mvp A C 7: 126,592,788 (GRCm39) Y374* probably null Het
Nabp2 G A 10: 128,245,497 (GRCm39) probably benign Het
Nos1 C T 5: 118,017,378 (GRCm39) P247L probably benign Het
Or10ag53 C A 2: 87,082,426 (GRCm39) F48L probably benign Het
Or9g4b T A 2: 85,616,062 (GRCm39) L69* probably null Het
Pik3cb C T 9: 98,953,461 (GRCm39) D441N probably damaging Het
Qrich1 C T 9: 108,418,935 (GRCm39) P464S possibly damaging Het
Rab17 A T 1: 90,887,860 (GRCm39) probably null Het
Relch A G 1: 105,592,239 (GRCm39) N136S probably damaging Het
Rspo3 A T 10: 29,382,443 (GRCm39) L77H probably damaging Het
Spn G T 7: 126,736,402 (GRCm39) T35K probably benign Het
Sult1d1 T A 5: 87,707,703 (GRCm39) Y139F possibly damaging Het
Tbc1d32 C A 10: 55,999,627 (GRCm39) Q848H probably damaging Het
Tcaf3 A G 6: 42,573,867 (GRCm39) V115A probably benign Het
Tram1l1 T A 3: 124,115,293 (GRCm39) L151* probably null Het
Trappc12 T A 12: 28,742,512 (GRCm39) I682L possibly damaging Het
Trav6d-4 A C 14: 52,991,056 (GRCm39) T31P probably damaging Het
Trpm8 A G 1: 88,275,910 (GRCm39) T503A probably benign Het
Virma T A 4: 11,542,116 (GRCm39) Y1567* probably null Het
Vmn1r228 T A 17: 20,996,943 (GRCm39) K192* probably null Het
Zfp521 T A 18: 13,977,330 (GRCm39) T1028S possibly damaging Het
Zfp583 T A 7: 6,320,397 (GRCm39) Q205L probably benign Het
Other mutations in Ank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Ank1 APN 8 23,631,660 (GRCm39) missense probably damaging 1.00
IGL01099:Ank1 APN 8 23,598,265 (GRCm39) missense probably damaging 0.97
IGL01586:Ank1 APN 8 23,610,928 (GRCm39) missense probably benign
IGL01866:Ank1 APN 8 23,583,871 (GRCm39) missense possibly damaging 0.88
IGL01977:Ank1 APN 8 23,605,449 (GRCm39) missense probably benign 0.01
IGL02109:Ank1 APN 8 23,586,200 (GRCm39) missense probably damaging 1.00
IGL02182:Ank1 APN 8 23,603,868 (GRCm39) missense possibly damaging 0.89
IGL02261:Ank1 APN 8 23,578,015 (GRCm39) missense probably damaging 1.00
IGL02283:Ank1 APN 8 23,609,450 (GRCm39) critical splice donor site probably null
IGL02335:Ank1 APN 8 23,625,654 (GRCm39) missense possibly damaging 0.86
IGL02933:Ank1 APN 8 23,612,881 (GRCm39) missense possibly damaging 0.52
IGL03056:Ank1 APN 8 23,631,195 (GRCm39) missense probably damaging 1.00
IGL03089:Ank1 APN 8 23,594,848 (GRCm39) missense probably benign 0.00
IGL03257:Ank1 APN 8 23,612,914 (GRCm39) missense probably damaging 1.00
IGL03389:Ank1 APN 8 23,578,076 (GRCm39) critical splice donor site probably null
Hema6 UTSW 8 23,587,653 (GRCm39) intron probably benign
BB006:Ank1 UTSW 8 23,606,123 (GRCm39) missense probably damaging 1.00
BB016:Ank1 UTSW 8 23,606,123 (GRCm39) missense probably damaging 1.00
R0030:Ank1 UTSW 8 23,583,909 (GRCm39) missense probably damaging 1.00
R0077:Ank1 UTSW 8 23,630,183 (GRCm39) missense probably damaging 1.00
R0081:Ank1 UTSW 8 23,606,258 (GRCm39) missense possibly damaging 0.95
R0147:Ank1 UTSW 8 23,613,993 (GRCm39) missense probably damaging 1.00
R0148:Ank1 UTSW 8 23,613,993 (GRCm39) missense probably damaging 1.00
R0200:Ank1 UTSW 8 23,586,828 (GRCm39) missense probably damaging 1.00
R0270:Ank1 UTSW 8 23,578,941 (GRCm39) splice site probably benign
R0309:Ank1 UTSW 8 23,594,825 (GRCm39) missense probably damaging 1.00
R0490:Ank1 UTSW 8 23,597,890 (GRCm39) splice site probably benign
R0675:Ank1 UTSW 8 23,600,400 (GRCm39) splice site probably benign
R0738:Ank1 UTSW 8 23,604,130 (GRCm39) missense probably damaging 0.98
R1051:Ank1 UTSW 8 23,583,956 (GRCm39) missense probably damaging 1.00
R1239:Ank1 UTSW 8 23,586,171 (GRCm39) missense probably damaging 1.00
R1265:Ank1 UTSW 8 23,607,053 (GRCm39) missense possibly damaging 0.64
R1367:Ank1 UTSW 8 23,601,819 (GRCm39) splice site probably benign
R1413:Ank1 UTSW 8 23,609,393 (GRCm39) missense probably damaging 1.00
R1539:Ank1 UTSW 8 23,583,935 (GRCm39) missense probably damaging 1.00
R1682:Ank1 UTSW 8 23,599,343 (GRCm39) missense probably damaging 1.00
R1732:Ank1 UTSW 8 23,601,479 (GRCm39) splice site probably benign
R1911:Ank1 UTSW 8 23,589,666 (GRCm39) missense probably damaging 1.00
R2087:Ank1 UTSW 8 23,583,827 (GRCm39) missense probably damaging 1.00
R2184:Ank1 UTSW 8 23,599,270 (GRCm39) missense probably damaging 0.98
R2302:Ank1 UTSW 8 23,609,415 (GRCm39) missense probably damaging 1.00
R2356:Ank1 UTSW 8 23,575,688 (GRCm39) missense probably damaging 1.00
R2495:Ank1 UTSW 8 23,622,280 (GRCm39) missense probably damaging 1.00
R3000:Ank1 UTSW 8 23,609,447 (GRCm39) missense probably damaging 1.00
R3113:Ank1 UTSW 8 23,574,813 (GRCm39) missense probably damaging 1.00
R3710:Ank1 UTSW 8 23,577,095 (GRCm39) missense probably damaging 1.00
R3768:Ank1 UTSW 8 23,606,202 (GRCm39) missense possibly damaging 0.92
R3771:Ank1 UTSW 8 23,613,913 (GRCm39) missense probably benign 0.03
R4002:Ank1 UTSW 8 23,629,479 (GRCm39) missense probably damaging 0.98
R4478:Ank1 UTSW 8 23,610,594 (GRCm39) missense probably benign 0.30
R4755:Ank1 UTSW 8 23,594,990 (GRCm39) missense probably damaging 1.00
R4756:Ank1 UTSW 8 23,612,893 (GRCm39) missense probably benign
R4979:Ank1 UTSW 8 23,622,212 (GRCm39) missense probably damaging 0.98
R4989:Ank1 UTSW 8 23,631,134 (GRCm39) intron probably benign
R5011:Ank1 UTSW 8 23,572,300 (GRCm39) missense probably damaging 1.00
R5013:Ank1 UTSW 8 23,572,300 (GRCm39) missense probably damaging 1.00
R5051:Ank1 UTSW 8 23,609,397 (GRCm39) missense probably damaging 1.00
R5059:Ank1 UTSW 8 23,586,204 (GRCm39) missense probably damaging 0.99
R5086:Ank1 UTSW 8 23,578,634 (GRCm39) missense probably damaging 1.00
R5108:Ank1 UTSW 8 23,622,571 (GRCm39) missense probably benign 0.11
R5235:Ank1 UTSW 8 23,572,212 (GRCm39) missense probably damaging 1.00
R5300:Ank1 UTSW 8 23,622,517 (GRCm39) missense probably benign 0.00
R5408:Ank1 UTSW 8 23,572,209 (GRCm39) missense probably damaging 1.00
R5537:Ank1 UTSW 8 23,604,892 (GRCm39) missense probably damaging 1.00
R5728:Ank1 UTSW 8 23,612,783 (GRCm39) critical splice acceptor site probably null
R5746:Ank1 UTSW 8 23,606,612 (GRCm39) missense probably damaging 1.00
R5837:Ank1 UTSW 8 23,594,806 (GRCm39) missense probably damaging 0.99
R5907:Ank1 UTSW 8 23,630,220 (GRCm39) missense probably damaging 1.00
R5997:Ank1 UTSW 8 23,589,678 (GRCm39) missense probably damaging 1.00
R6005:Ank1 UTSW 8 23,622,218 (GRCm39) missense probably damaging 1.00
R6046:Ank1 UTSW 8 23,606,114 (GRCm39) missense probably damaging 1.00
R6103:Ank1 UTSW 8 23,603,999 (GRCm39) missense probably damaging 1.00
R6268:Ank1 UTSW 8 23,599,687 (GRCm39) missense probably damaging 1.00
R6430:Ank1 UTSW 8 23,622,125 (GRCm39) missense probably damaging 1.00
R6457:Ank1 UTSW 8 23,577,983 (GRCm39) missense probably damaging 1.00
R6626:Ank1 UTSW 8 23,465,207 (GRCm39) missense probably damaging 0.98
R6935:Ank1 UTSW 8 23,598,247 (GRCm39) missense probably damaging 1.00
R7091:Ank1 UTSW 8 23,548,679 (GRCm39) missense probably benign
R7162:Ank1 UTSW 8 23,622,370 (GRCm39) missense possibly damaging 0.94
R7475:Ank1 UTSW 8 23,622,646 (GRCm39) missense probably benign
R7546:Ank1 UTSW 8 23,555,011 (GRCm39) missense probably damaging 1.00
R7678:Ank1 UTSW 8 23,607,074 (GRCm39) missense probably damaging 0.98
R7768:Ank1 UTSW 8 23,588,013 (GRCm39) missense probably benign 0.01
R7779:Ank1 UTSW 8 23,586,763 (GRCm39) critical splice acceptor site probably null
R7864:Ank1 UTSW 8 23,577,976 (GRCm39) missense probably damaging 1.00
R7929:Ank1 UTSW 8 23,606,123 (GRCm39) missense probably damaging 1.00
R7982:Ank1 UTSW 8 23,609,397 (GRCm39) missense probably damaging 1.00
R7984:Ank1 UTSW 8 23,578,982 (GRCm39) missense probably damaging 1.00
R8273:Ank1 UTSW 8 23,575,668 (GRCm39) missense probably damaging 1.00
R8318:Ank1 UTSW 8 23,605,567 (GRCm39) missense probably damaging 0.99
R8349:Ank1 UTSW 8 23,629,302 (GRCm39) missense possibly damaging 0.66
R8449:Ank1 UTSW 8 23,629,302 (GRCm39) missense possibly damaging 0.66
R8459:Ank1 UTSW 8 23,605,528 (GRCm39) missense probably damaging 1.00
R8506:Ank1 UTSW 8 23,586,851 (GRCm39) missense probably damaging 1.00
R8889:Ank1 UTSW 8 23,606,990 (GRCm39) missense probably damaging 1.00
R8893:Ank1 UTSW 8 23,598,241 (GRCm39) missense probably damaging 1.00
R8924:Ank1 UTSW 8 23,589,011 (GRCm39) missense probably benign 0.00
R8993:Ank1 UTSW 8 23,588,955 (GRCm39) missense probably damaging 1.00
R9016:Ank1 UTSW 8 23,606,264 (GRCm39) missense probably null 0.99
R9017:Ank1 UTSW 8 23,606,264 (GRCm39) missense probably null 0.99
R9018:Ank1 UTSW 8 23,606,264 (GRCm39) missense probably null 0.99
R9086:Ank1 UTSW 8 23,589,636 (GRCm39) missense probably damaging 0.96
R9154:Ank1 UTSW 8 23,605,387 (GRCm39) missense probably damaging 0.96
R9194:Ank1 UTSW 8 23,606,255 (GRCm39) missense possibly damaging 0.64
R9347:Ank1 UTSW 8 23,607,076 (GRCm39) missense possibly damaging 0.65
R9419:Ank1 UTSW 8 23,574,825 (GRCm39) missense probably damaging 1.00
R9452:Ank1 UTSW 8 23,622,429 (GRCm39) missense probably benign 0.00
R9568:Ank1 UTSW 8 23,609,381 (GRCm39) missense probably benign
R9689:Ank1 UTSW 8 23,631,253 (GRCm39) missense probably benign
R9747:Ank1 UTSW 8 23,576,993 (GRCm39) missense probably damaging 0.97
RF024:Ank1 UTSW 8 23,609,360 (GRCm39) missense probably benign 0.37
X0066:Ank1 UTSW 8 23,631,600 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGCCGTGTTGTAGGGTGAC -3'
(R):5'- CAAAACCTCTGAAGTTGCCTAAGAC -3'

Sequencing Primer
(F):5'- ACGAGTGGATCCGGGTTC -3'
(R):5'- GACCTTTTCACAGGGGTAGCATATC -3'
Posted On 2016-06-06