Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:Pik3cb'

391698

Institutional Source

Beutler Lab

Gene Symbol

Pik3cb

Ensembl Gene

ENSMUSG00000032462

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta

Synonyms

p110beta, 1110001J02Rik

MMRRC Submission

042622-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R5031 (G1)

Quality Score

199

Status

Validated

Chromosome

Chromosomal Location

99036654-99140621 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 99071408 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 441 (D441N)

Ref Sequence

ENSEMBL: ENSMUSP00000035037 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035037] [ENSMUST00000136965]

AlphaFold

Q8BTI9

PDB Structure

CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Discovery and Optimization of Pyrimidone Indoline Amide PI3Kbeta Inhibitors for the Treatment of Phosphatase and TENsin homologue (PTEN)-Deficient Cancers [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035037
AA Change: D441N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000035037
Gene: ENSMUSG00000032462
AA Change: D441N

Domain	Start	End	E-Value	Type
PI3K_p85B	35	112	2.44e-50	SMART
PI3K_rbd	174	282	1.88e-42	SMART
low complexity region	305	311	N/A	INTRINSIC
PI3K_C2	315	417	4.64e-33	SMART
PI3Ka	519	705	1.08e-92	SMART
PI3Kc	795	1061	8.75e-134	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000136965
AA Change: D441N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138346
Gene: ENSMUSG00000032462
AA Change: D441N

Domain	Start	End	E-Value	Type
PI3K_p85B	35	112	2.44e-50	SMART
PI3K_rbd	174	282	1.88e-42	SMART
low complexity region	305	311	N/A	INTRINSIC
PI3K_C2	315	417	4.64e-33	SMART
Blast:PI3Ka	450	520	1e-37	BLAST

Meta Mutation Damage Score

0.7637

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit 30% fetal lethality, decreased size at birth and postnatally, abnormal glucose homeostasis, and dyslipidemia. Mice homozygous for a different knock-out allele die prior to E8.5 [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,664,514	N136S	probably damaging	Het
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
Atr	A	G	9: 95,865,702	K346E	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Baz2b	T	C	2: 59,912,807	R1607G	probably benign	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Dock1	A	G	7: 135,152,246	D1584G	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gsap	G	A	5: 21,242,826	S294N	possibly damaging	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Irs1	A	T	1: 82,286,967	L1176*	probably null	Het
Klhl29	C	T	12: 5,091,334	R550Q	probably benign	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Magel2	T	C	7: 62,380,104	S919P	unknown	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Qrich1	C	T	9: 108,541,736	P464S	possibly damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tram1l1	T	A	3: 124,321,644	L151*	probably null	Het
Trappc12	T	A	12: 28,692,513	I682L	possibly damaging	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Trpm8	A	G	1: 88,348,188	T503A	probably benign	Het
Virma	T	A	4: 11,542,116	Y1567*	probably null	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in Pik3cb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Pik3cb	APN	9	99101286	missense	probably damaging	0.96
IGL01354:Pik3cb	APN	9	99064168	missense	possibly damaging	0.83
IGL02132:Pik3cb	APN	9	99071377	missense	probably benign	0.01
IGL02268:Pik3cb	APN	9	99046556	missense	probably benign	0.00
IGL02376:Pik3cb	APN	9	99052352	missense	probably benign	0.00
IGL02378:Pik3cb	APN	9	99062840	missense	probably benign	0.40
IGL02748:Pik3cb	APN	9	99062968	splice site	probably benign
IGL03038:Pik3cb	APN	9	99065597	missense	probably damaging	1.00
IGL03142:Pik3cb	APN	9	99065562	missense	probably benign	0.10
H8786:Pik3cb	UTSW	9	99046559	missense	possibly damaging	0.80
R0071:Pik3cb	UTSW	9	99044865	missense	probably benign	0.02
R0071:Pik3cb	UTSW	9	99044865	missense	probably benign	0.02
R0305:Pik3cb	UTSW	9	99064076	missense	possibly damaging	0.86
R0464:Pik3cb	UTSW	9	99044743	critical splice donor site	probably null
R0635:Pik3cb	UTSW	9	99064218	splice site	probably benign
R1386:Pik3cb	UTSW	9	99064027	missense	possibly damaging	0.90
R1530:Pik3cb	UTSW	9	99053973	missense	probably damaging	0.96
R1802:Pik3cb	UTSW	9	99101289	nonsense	probably null
R1815:Pik3cb	UTSW	9	99093095	missense	possibly damaging	0.93
R2011:Pik3cb	UTSW	9	99105579	nonsense	probably null
R2079:Pik3cb	UTSW	9	99060204	missense	probably benign	0.27
R2153:Pik3cb	UTSW	9	99101244	nonsense	probably null
R2237:Pik3cb	UTSW	9	99041028	missense	probably damaging	1.00
R2238:Pik3cb	UTSW	9	99041028	missense	probably damaging	1.00
R2513:Pik3cb	UTSW	9	99061842	missense	probably damaging	1.00
R3982:Pik3cb	UTSW	9	99046601	missense	probably benign	0.06
R4009:Pik3cb	UTSW	9	99040929	missense	probably damaging	0.98
R4246:Pik3cb	UTSW	9	99101176	splice site	probably null
R4248:Pik3cb	UTSW	9	99101176	splice site	probably null
R4249:Pik3cb	UTSW	9	99101176	splice site	probably null
R4334:Pik3cb	UTSW	9	99061851	missense	probably damaging	1.00
R4544:Pik3cb	UTSW	9	99039759	missense	probably damaging	1.00
R4568:Pik3cb	UTSW	9	99090302	missense	probably benign	0.00
R4571:Pik3cb	UTSW	9	99090257	missense	possibly damaging	0.94
R4595:Pik3cb	UTSW	9	99055406	missense	possibly damaging	0.95
R4599:Pik3cb	UTSW	9	99061764	missense	probably benign	0.15
R4820:Pik3cb	UTSW	9	99073626	missense	probably benign	0.00
R4887:Pik3cb	UTSW	9	99101328	missense	probably damaging	0.99
R4967:Pik3cb	UTSW	9	99105632	missense	probably benign	0.14
R5029:Pik3cb	UTSW	9	99054060	missense	probably damaging	0.98
R5394:Pik3cb	UTSW	9	99088663	missense	probably benign
R5769:Pik3cb	UTSW	9	99093159	nonsense	probably null
R6128:Pik3cb	UTSW	9	99064099	missense	possibly damaging	0.95
R6250:Pik3cb	UTSW	9	99094598	missense	probably benign	0.01
R6354:Pik3cb	UTSW	9	99073643	missense	probably benign	0.00
R6370:Pik3cb	UTSW	9	99040934	missense	probably damaging	1.00
R6664:Pik3cb	UTSW	9	99094538	missense	possibly damaging	0.56
R6665:Pik3cb	UTSW	9	99073649	missense	probably benign	0.00
R6751:Pik3cb	UTSW	9	99094521	missense	probably benign
R6781:Pik3cb	UTSW	9	99040992	missense	possibly damaging	0.52
R6869:Pik3cb	UTSW	9	99060259	missense	probably benign	0.08
R6883:Pik3cb	UTSW	9	99101400	missense	probably benign	0.00
R7150:Pik3cb	UTSW	9	99093090	missense	probably damaging	1.00
R7446:Pik3cb	UTSW	9	99046658	missense	probably damaging	1.00
R7679:Pik3cb	UTSW	9	99088607	missense	probably benign	0.05
R7831:Pik3cb	UTSW	9	99088613	missense	probably benign
R8300:Pik3cb	UTSW	9	99046658	missense	probably damaging	1.00
R8837:Pik3cb	UTSW	9	99054064	missense	possibly damaging	0.65
R8911:Pik3cb	UTSW	9	99064148	missense	probably benign	0.40
R9299:Pik3cb	UTSW	9	99061791	missense	probably damaging	1.00
R9337:Pik3cb	UTSW	9	99061791	missense	probably damaging	1.00
R9477:Pik3cb	UTSW	9	99040920	critical splice donor site	probably null
R9641:Pik3cb	UTSW	9	99073736	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCCAGAACTAAGCACTGC -3'
(R):5'- TTCTGTCCGTGTGCATACTG -3'

Sequencing Primer
(F):5'- CTGCCGTTAAGAATCTTAGCCAGTG -3'
(R):5'- AGTTATGAAGATACTGAAATGGCTAC -3'

Posted On

2016-06-06